/Tools/stringbench/stringbench.py
https://github.com/albertz/CPython · Python · 1482 lines · 1225 code · 216 blank · 41 comment · 182 complexity · 3207f8cc5a4a924b3f4596c9997e262a MD5 · raw file
- # Various microbenchmarks comparing unicode and byte string performance
- # Please keep this file both 2.x and 3.x compatible!
- import timeit
- import itertools
- import operator
- import re
- import sys
- import datetime
- import optparse
- VERSION = '2.0'
- def p(*args):
- sys.stdout.write(' '.join(str(s) for s in args) + '\n')
- if sys.version_info >= (3,):
- BYTES = bytes_from_str = lambda x: x.encode('ascii')
- UNICODE = unicode_from_str = lambda x: x
- else:
- BYTES = bytes_from_str = lambda x: x
- UNICODE = unicode_from_str = lambda x: x.decode('ascii')
- class UnsupportedType(TypeError):
- pass
- p('stringbench v%s' % VERSION)
- p(sys.version)
- p(datetime.datetime.now())
- REPEAT = 1
- REPEAT = 3
- #REPEAT = 7
- if __name__ != "__main__":
- raise SystemExit("Must run as main program")
- parser = optparse.OptionParser()
- parser.add_option("-R", "--skip-re", dest="skip_re",
- action="store_true",
- help="skip regular expression tests")
- parser.add_option("-8", "--8-bit", dest="bytes_only",
- action="store_true",
- help="only do 8-bit string benchmarks")
- parser.add_option("-u", "--unicode", dest="unicode_only",
- action="store_true",
- help="only do Unicode string benchmarks")
- _RANGE_1000 = list(range(1000))
- _RANGE_100 = list(range(100))
- _RANGE_10 = list(range(10))
- dups = {}
- def bench(s, group, repeat_count):
- def blah(f):
- if f.__name__ in dups:
- raise AssertionError("Multiple functions with same name: %r" %
- (f.__name__,))
- dups[f.__name__] = 1
- f.comment = s
- f.is_bench = True
- f.group = group
- f.repeat_count = repeat_count
- return f
- return blah
- def uses_re(f):
- f.uses_re = True
- ####### 'in' comparisons
- @bench('"A" in "A"*1000', "early match, single character", 1000)
- def in_test_quick_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("A")
- for x in _RANGE_1000:
- s2 in s1
- @bench('"B" in "A"*1000', "no match, single character", 1000)
- def in_test_no_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("B")
- for x in _RANGE_1000:
- s2 in s1
- @bench('"AB" in "AB"*1000', "early match, two characters", 1000)
- def in_test_quick_match_two_characters(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("AB")
- for x in _RANGE_1000:
- s2 in s1
- @bench('"BC" in "AB"*1000', "no match, two characters", 1000)
- def in_test_no_match_two_character(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("BC")
- for x in _RANGE_1000:
- s2 in s1
- @bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000)
- def in_test_slow_match_two_characters(STR):
- s1 = STR("AB" * 300+"C")
- s2 = STR("BC")
- for x in _RANGE_1000:
- s2 in s1
- @bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")',
- "late match, 100 characters", 100)
- def in_test_slow_match_100_characters(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = (m+d)*300 + m+e
- s2 = m+e
- for x in _RANGE_100:
- s2 in s1
- # Try with regex
- @uses_re
- @bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")',
- "late match, 100 characters", 100)
- def re_test_slow_match_100_characters(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = (m+d)*300 + m+e
- s2 = m+e
- pat = re.compile(s2)
- search = pat.search
- for x in _RANGE_100:
- search(s1)
- #### same tests as 'in' but use 'find'
- @bench('("A"*1000).find("A")', "early match, single character", 1000)
- def find_test_quick_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("A")
- s1_find = s1.find
- for x in _RANGE_1000:
- s1_find(s2)
- @bench('("A"*1000).find("B")', "no match, single character", 1000)
- def find_test_no_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("B")
- s1_find = s1.find
- for x in _RANGE_1000:
- s1_find(s2)
- @bench('("AB"*1000).find("AB")', "early match, two characters", 1000)
- def find_test_quick_match_two_characters(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("AB")
- s1_find = s1.find
- for x in _RANGE_1000:
- s1_find(s2)
- @bench('("AB"*1000).find("BC")', "no match, two characters", 1000)
- def find_test_no_match_two_character(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("BC")
- s1_find = s1.find
- for x in _RANGE_1000:
- s1_find(s2)
- @bench('("AB"*1000).find("CA")', "no match, two characters", 1000)
- def find_test_no_match_two_character_bis(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("CA")
- s1_find = s1.find
- for x in _RANGE_1000:
- s1_find(s2)
- @bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000)
- def find_test_slow_match_two_characters(STR):
- s1 = STR("AB" * 300+"C")
- s2 = STR("BC")
- s1_find = s1.find
- for x in _RANGE_1000:
- s1_find(s2)
- @bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000)
- def find_test_slow_match_two_characters_bis(STR):
- s1 = STR("AB" * 300+"CA")
- s2 = STR("CA")
- s1_find = s1.find
- for x in _RANGE_1000:
- s1_find(s2)
- @bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s+"E")',
- "late match, 100 characters", 100)
- def find_test_slow_match_100_characters(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = (m+d)*500 + m+e
- s2 = m+e
- s1_find = s1.find
- for x in _RANGE_100:
- s1_find(s2)
- @bench('s="ABC"*33; ((s+"D")*500+"E"+s).find("E"+s)',
- "late match, 100 characters", 100)
- def find_test_slow_match_100_characters_bis(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = (m+d)*500 + e+m
- s2 = e+m
- s1_find = s1.find
- for x in _RANGE_100:
- s1_find(s2)
- #### Same tests for 'rfind'
- @bench('("A"*1000).rfind("A")', "early match, single character", 1000)
- def rfind_test_quick_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("A")
- s1_rfind = s1.rfind
- for x in _RANGE_1000:
- s1_rfind(s2)
- @bench('("A"*1000).rfind("B")', "no match, single character", 1000)
- def rfind_test_no_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("B")
- s1_rfind = s1.rfind
- for x in _RANGE_1000:
- s1_rfind(s2)
- @bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000)
- def rfind_test_quick_match_two_characters(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("AB")
- s1_rfind = s1.rfind
- for x in _RANGE_1000:
- s1_rfind(s2)
- @bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000)
- def rfind_test_no_match_two_character(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("BC")
- s1_rfind = s1.rfind
- for x in _RANGE_1000:
- s1_rfind(s2)
- @bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000)
- def rfind_test_no_match_two_character_bis(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("CA")
- s1_rfind = s1.rfind
- for x in _RANGE_1000:
- s1_rfind(s2)
- @bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000)
- def rfind_test_slow_match_two_characters(STR):
- s1 = STR("C" + "AB" * 300)
- s2 = STR("CA")
- s1_rfind = s1.rfind
- for x in _RANGE_1000:
- s1_rfind(s2)
- @bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000)
- def rfind_test_slow_match_two_characters_bis(STR):
- s1 = STR("BC" + "AB" * 300)
- s2 = STR("BC")
- s1_rfind = s1.rfind
- for x in _RANGE_1000:
- s1_rfind(s2)
- @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rfind("E"+s)',
- "late match, 100 characters", 100)
- def rfind_test_slow_match_100_characters(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = e+m + (d+m)*500
- s2 = e+m
- s1_rfind = s1.rfind
- for x in _RANGE_100:
- s1_rfind(s2)
- @bench('s="ABC"*33; (s+"E"+("D"+s)*500).rfind(s+"E")',
- "late match, 100 characters", 100)
- def rfind_test_slow_match_100_characters_bis(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = m+e + (d+m)*500
- s2 = m+e
- s1_rfind = s1.rfind
- for x in _RANGE_100:
- s1_rfind(s2)
- #### Now with index.
- # Skip the ones which fail because that would include exception overhead.
- @bench('("A"*1000).index("A")', "early match, single character", 1000)
- def index_test_quick_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("A")
- s1_index = s1.index
- for x in _RANGE_1000:
- s1_index(s2)
- @bench('("AB"*1000).index("AB")', "early match, two characters", 1000)
- def index_test_quick_match_two_characters(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("AB")
- s1_index = s1.index
- for x in _RANGE_1000:
- s1_index(s2)
- @bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000)
- def index_test_slow_match_two_characters(STR):
- s1 = STR("AB" * 300+"C")
- s2 = STR("BC")
- s1_index = s1.index
- for x in _RANGE_1000:
- s1_index(s2)
- @bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s+"E")',
- "late match, 100 characters", 100)
- def index_test_slow_match_100_characters(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = (m+d)*500 + m+e
- s2 = m+e
- s1_index = s1.index
- for x in _RANGE_100:
- s1_index(s2)
- #### Same for rindex
- @bench('("A"*1000).rindex("A")', "early match, single character", 1000)
- def rindex_test_quick_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("A")
- s1_rindex = s1.rindex
- for x in _RANGE_1000:
- s1_rindex(s2)
- @bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000)
- def rindex_test_quick_match_two_characters(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("AB")
- s1_rindex = s1.rindex
- for x in _RANGE_1000:
- s1_rindex(s2)
- @bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000)
- def rindex_test_slow_match_two_characters(STR):
- s1 = STR("C" + "AB" * 300)
- s2 = STR("CA")
- s1_rindex = s1.rindex
- for x in _RANGE_1000:
- s1_rindex(s2)
- @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rindex("E"+s)',
- "late match, 100 characters", 100)
- def rindex_test_slow_match_100_characters(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = e + m + (d+m)*500
- s2 = e + m
- s1_rindex = s1.rindex
- for x in _RANGE_100:
- s1_rindex(s2)
- #### Same for partition
- @bench('("A"*1000).partition("A")', "early match, single character", 1000)
- def partition_test_quick_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("A")
- s1_partition = s1.partition
- for x in _RANGE_1000:
- s1_partition(s2)
- @bench('("A"*1000).partition("B")', "no match, single character", 1000)
- def partition_test_no_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("B")
- s1_partition = s1.partition
- for x in _RANGE_1000:
- s1_partition(s2)
- @bench('("AB"*1000).partition("AB")', "early match, two characters", 1000)
- def partition_test_quick_match_two_characters(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("AB")
- s1_partition = s1.partition
- for x in _RANGE_1000:
- s1_partition(s2)
- @bench('("AB"*1000).partition("BC")', "no match, two characters", 1000)
- def partition_test_no_match_two_character(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("BC")
- s1_partition = s1.partition
- for x in _RANGE_1000:
- s1_partition(s2)
- @bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000)
- def partition_test_slow_match_two_characters(STR):
- s1 = STR("AB" * 300+"C")
- s2 = STR("BC")
- s1_partition = s1.partition
- for x in _RANGE_1000:
- s1_partition(s2)
- @bench('s="ABC"*33; ((s+"D")*500+s+"E").partition(s+"E")',
- "late match, 100 characters", 100)
- def partition_test_slow_match_100_characters(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = (m+d)*500 + m+e
- s2 = m+e
- s1_partition = s1.partition
- for x in _RANGE_100:
- s1_partition(s2)
- #### Same for rpartition
- @bench('("A"*1000).rpartition("A")', "early match, single character", 1000)
- def rpartition_test_quick_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("A")
- s1_rpartition = s1.rpartition
- for x in _RANGE_1000:
- s1_rpartition(s2)
- @bench('("A"*1000).rpartition("B")', "no match, single character", 1000)
- def rpartition_test_no_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("B")
- s1_rpartition = s1.rpartition
- for x in _RANGE_1000:
- s1_rpartition(s2)
- @bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000)
- def rpartition_test_quick_match_two_characters(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("AB")
- s1_rpartition = s1.rpartition
- for x in _RANGE_1000:
- s1_rpartition(s2)
- @bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000)
- def rpartition_test_no_match_two_character(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("BC")
- s1_rpartition = s1.rpartition
- for x in _RANGE_1000:
- s1_rpartition(s2)
- @bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000)
- def rpartition_test_slow_match_two_characters(STR):
- s1 = STR("C" + "AB" * 300)
- s2 = STR("CA")
- s1_rpartition = s1.rpartition
- for x in _RANGE_1000:
- s1_rpartition(s2)
- @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rpartition("E"+s)',
- "late match, 100 characters", 100)
- def rpartition_test_slow_match_100_characters(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = e + m + (d+m)*500
- s2 = e + m
- s1_rpartition = s1.rpartition
- for x in _RANGE_100:
- s1_rpartition(s2)
- #### Same for split(s, 1)
- @bench('("A"*1000).split("A", 1)', "early match, single character", 1000)
- def split_test_quick_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("A")
- s1_split = s1.split
- for x in _RANGE_1000:
- s1_split(s2, 1)
- @bench('("A"*1000).split("B", 1)', "no match, single character", 1000)
- def split_test_no_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("B")
- s1_split = s1.split
- for x in _RANGE_1000:
- s1_split(s2, 1)
- @bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000)
- def split_test_quick_match_two_characters(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("AB")
- s1_split = s1.split
- for x in _RANGE_1000:
- s1_split(s2, 1)
- @bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000)
- def split_test_no_match_two_character(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("BC")
- s1_split = s1.split
- for x in _RANGE_1000:
- s1_split(s2, 1)
- @bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000)
- def split_test_slow_match_two_characters(STR):
- s1 = STR("AB" * 300+"C")
- s2 = STR("BC")
- s1_split = s1.split
- for x in _RANGE_1000:
- s1_split(s2, 1)
- @bench('s="ABC"*33; ((s+"D")*500+s+"E").split(s+"E", 1)',
- "late match, 100 characters", 100)
- def split_test_slow_match_100_characters(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = (m+d)*500 + m+e
- s2 = m+e
- s1_split = s1.split
- for x in _RANGE_100:
- s1_split(s2, 1)
- #### Same for rsplit(s, 1)
- @bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000)
- def rsplit_test_quick_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("A")
- s1_rsplit = s1.rsplit
- for x in _RANGE_1000:
- s1_rsplit(s2, 1)
- @bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000)
- def rsplit_test_no_match_single_character(STR):
- s1 = STR("A" * 1000)
- s2 = STR("B")
- s1_rsplit = s1.rsplit
- for x in _RANGE_1000:
- s1_rsplit(s2, 1)
- @bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000)
- def rsplit_test_quick_match_two_characters(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("AB")
- s1_rsplit = s1.rsplit
- for x in _RANGE_1000:
- s1_rsplit(s2, 1)
- @bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000)
- def rsplit_test_no_match_two_character(STR):
- s1 = STR("AB" * 1000)
- s2 = STR("BC")
- s1_rsplit = s1.rsplit
- for x in _RANGE_1000:
- s1_rsplit(s2, 1)
- @bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000)
- def rsplit_test_slow_match_two_characters(STR):
- s1 = STR("C" + "AB" * 300)
- s2 = STR("CA")
- s1_rsplit = s1.rsplit
- for x in _RANGE_1000:
- s1_rsplit(s2, 1)
- @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rsplit("E"+s, 1)',
- "late match, 100 characters", 100)
- def rsplit_test_slow_match_100_characters(STR):
- m = STR("ABC"*33)
- d = STR("D")
- e = STR("E")
- s1 = e + m + (d+m)*500
- s2 = e + m
- s1_rsplit = s1.rsplit
- for x in _RANGE_100:
- s1_rsplit(s2, 1)
- #### Benchmark the operator-based methods
- @bench('"A"*10', "repeat 1 character 10 times", 1000)
- def repeat_single_10_times(STR):
- s = STR("A")
- for x in _RANGE_1000:
- s * 10
- @bench('"A"*1000', "repeat 1 character 1000 times", 1000)
- def repeat_single_1000_times(STR):
- s = STR("A")
- for x in _RANGE_1000:
- s * 1000
- @bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000)
- def repeat_5_10_times(STR):
- s = STR("ABCDE")
- for x in _RANGE_1000:
- s * 10
- @bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000)
- def repeat_5_1000_times(STR):
- s = STR("ABCDE")
- for x in _RANGE_1000:
- s * 1000
- # + for concat
- @bench('"Andrew"+"Dalke"', "concat two strings", 1000)
- def concat_two_strings(STR):
- s1 = STR("Andrew")
- s2 = STR("Dalke")
- for x in _RANGE_1000:
- s1+s2
- @bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15",
- 1000)
- def concat_many_strings(STR):
- s1=STR('TIXSGYNREDCVBHJ')
- s2=STR('PUMTLXBZVDO')
- s3=STR('FVZNJ')
- s4=STR('OGDXUW')
- s5=STR('WEIMRNCOYVGHKB')
- s6=STR('FCQTNMXPUZH')
- s7=STR('TICZJYRLBNVUEAK')
- s8=STR('REYB')
- s9=STR('PWUOQ')
- s10=STR('EQHCMKBS')
- s11=STR('AEVDFOH')
- s12=STR('IFHVD')
- s13=STR('JGTCNLXWOHQ')
- s14=STR('ITSKEPYLROZAWXF')
- s15=STR('THEK')
- s16=STR('GHPZFBUYCKMNJIT')
- s17=STR('JMUZ')
- s18=STR('WLZQMTB')
- s19=STR('KPADCBW')
- s20=STR('TNJHZQAGBU')
- for x in _RANGE_1000:
- (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+
- s11+s12+s13+s14+s15+s16+s17+s18+s19+s20)
- #### Benchmark join
- def get_bytes_yielding_seq(STR, arg):
- if STR is BYTES and sys.version_info >= (3,):
- raise UnsupportedType
- return STR(arg)
- @bench('"A".join("")',
- "join empty string, with 1 character sep", 100)
- def join_empty_single(STR):
- sep = STR("A")
- s2 = get_bytes_yielding_seq(STR, "")
- sep_join = sep.join
- for x in _RANGE_100:
- sep_join(s2)
- @bench('"ABCDE".join("")',
- "join empty string, with 5 character sep", 100)
- def join_empty_5(STR):
- sep = STR("ABCDE")
- s2 = get_bytes_yielding_seq(STR, "")
- sep_join = sep.join
- for x in _RANGE_100:
- sep_join(s2)
- @bench('"A".join("ABC..Z")',
- "join string with 26 characters, with 1 character sep", 1000)
- def join_alphabet_single(STR):
- sep = STR("A")
- s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
- sep_join = sep.join
- for x in _RANGE_1000:
- sep_join(s2)
- @bench('"ABCDE".join("ABC..Z")',
- "join string with 26 characters, with 5 character sep", 1000)
- def join_alphabet_5(STR):
- sep = STR("ABCDE")
- s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
- sep_join = sep.join
- for x in _RANGE_1000:
- sep_join(s2)
- @bench('"A".join(list("ABC..Z"))',
- "join list of 26 characters, with 1 character sep", 1000)
- def join_alphabet_list_single(STR):
- sep = STR("A")
- s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
- sep_join = sep.join
- for x in _RANGE_1000:
- sep_join(s2)
- @bench('"ABCDE".join(list("ABC..Z"))',
- "join list of 26 characters, with 5 character sep", 1000)
- def join_alphabet_list_five(STR):
- sep = STR("ABCDE")
- s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
- sep_join = sep.join
- for x in _RANGE_1000:
- sep_join(s2)
- @bench('"A".join(["Bob"]*100))',
- "join list of 100 words, with 1 character sep", 1000)
- def join_100_words_single(STR):
- sep = STR("A")
- s2 = [STR("Bob")]*100
- sep_join = sep.join
- for x in _RANGE_1000:
- sep_join(s2)
- @bench('"ABCDE".join(["Bob"]*100))',
- "join list of 100 words, with 5 character sep", 1000)
- def join_100_words_5(STR):
- sep = STR("ABCDE")
- s2 = [STR("Bob")]*100
- sep_join = sep.join
- for x in _RANGE_1000:
- sep_join(s2)
- #### split tests
- @bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000)
- def whitespace_split(STR):
- s = STR("Here are some words. "*2)
- s_split = s.split
- for x in _RANGE_1000:
- s_split()
- @bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000)
- def whitespace_rsplit(STR):
- s = STR("Here are some words. "*2)
- s_rsplit = s.rsplit
- for x in _RANGE_1000:
- s_rsplit()
- @bench('("Here are some words. "*2).split(None, 1)',
- "split 1 whitespace", 1000)
- def whitespace_split_1(STR):
- s = STR("Here are some words. "*2)
- s_split = s.split
- N = None
- for x in _RANGE_1000:
- s_split(N, 1)
- @bench('("Here are some words. "*2).rsplit(None, 1)',
- "split 1 whitespace", 1000)
- def whitespace_rsplit_1(STR):
- s = STR("Here are some words. "*2)
- s_rsplit = s.rsplit
- N = None
- for x in _RANGE_1000:
- s_rsplit(N, 1)
- @bench('("Here are some words. "*2).partition(" ")',
- "split 1 whitespace", 1000)
- def whitespace_partition(STR):
- sep = STR(" ")
- s = STR("Here are some words. "*2)
- s_partition = s.partition
- for x in _RANGE_1000:
- s_partition(sep)
- @bench('("Here are some words. "*2).rpartition(" ")',
- "split 1 whitespace", 1000)
- def whitespace_rpartition(STR):
- sep = STR(" ")
- s = STR("Here are some words. "*2)
- s_rpartition = s.rpartition
- for x in _RANGE_1000:
- s_rpartition(sep)
- human_text = """\
- Python is a dynamic object-oriented programming language that can be
- used for many kinds of software development. It offers strong support
- for integration with other languages and tools, comes with extensive
- standard libraries, and can be learned in a few days. Many Python
- programmers report substantial productivity gains and feel the language
- encourages the development of higher quality, more maintainable code.
- Python runs on Windows, Linux/Unix, Mac OS X, Amiga, Palm
- Handhelds, and Nokia mobile phones. Python has also been ported to the
- Java and .NET virtual machines.
- Python is distributed under an OSI-approved open source license that
- makes it free to use, even for commercial products.
- """*25
- human_text_bytes = bytes_from_str(human_text)
- human_text_unicode = unicode_from_str(human_text)
- def _get_human_text(STR):
- if STR is UNICODE:
- return human_text_unicode
- if STR is BYTES:
- return human_text_bytes
- raise AssertionError
- @bench('human_text.split()', "split whitespace (huge)", 10)
- def whitespace_split_huge(STR):
- s = _get_human_text(STR)
- s_split = s.split
- for x in _RANGE_10:
- s_split()
- @bench('human_text.rsplit()', "split whitespace (huge)", 10)
- def whitespace_rsplit_huge(STR):
- s = _get_human_text(STR)
- s_rsplit = s.rsplit
- for x in _RANGE_10:
- s_rsplit()
- @bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000)
- def newlines_split(STR):
- s = STR("this\nis\na\ntest\n")
- s_split = s.split
- nl = STR("\n")
- for x in _RANGE_1000:
- s_split(nl)
- @bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000)
- def newlines_rsplit(STR):
- s = STR("this\nis\na\ntest\n")
- s_rsplit = s.rsplit
- nl = STR("\n")
- for x in _RANGE_1000:
- s_rsplit(nl)
- @bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000)
- def newlines_splitlines(STR):
- s = STR("this\nis\na\ntest\n")
- s_splitlines = s.splitlines
- for x in _RANGE_1000:
- s_splitlines()
- ## split text with 2000 newlines
- def _make_2000_lines():
- import random
- r = random.Random(100)
- chars = list(map(chr, range(32, 128)))
- i = 0
- while i < len(chars):
- chars[i] = " "
- i += r.randrange(9)
- s = "".join(chars)
- s = s*4
- words = []
- for i in range(2000):
- start = r.randrange(96)
- n = r.randint(5, 65)
- words.append(s[start:start+n])
- return "\n".join(words)+"\n"
- _text_with_2000_lines = _make_2000_lines()
- _text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines)
- _text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines)
- def _get_2000_lines(STR):
- if STR is UNICODE:
- return _text_with_2000_lines_unicode
- if STR is BYTES:
- return _text_with_2000_lines_bytes
- raise AssertionError
- @bench('"...text...".split("\\n")', "split 2000 newlines", 10)
- def newlines_split_2000(STR):
- s = _get_2000_lines(STR)
- s_split = s.split
- nl = STR("\n")
- for x in _RANGE_10:
- s_split(nl)
- @bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10)
- def newlines_rsplit_2000(STR):
- s = _get_2000_lines(STR)
- s_rsplit = s.rsplit
- nl = STR("\n")
- for x in _RANGE_10:
- s_rsplit(nl)
- @bench('"...text...".splitlines()', "split 2000 newlines", 10)
- def newlines_splitlines_2000(STR):
- s = _get_2000_lines(STR)
- s_splitlines = s.splitlines
- for x in _RANGE_10:
- s_splitlines()
- ## split text on "--" characters
- @bench(
- '"this--is--a--test--of--the--emergency--broadcast--system".split("--")',
- "split on multicharacter separator (small)", 1000)
- def split_multichar_sep_small(STR):
- s = STR("this--is--a--test--of--the--emergency--broadcast--system")
- s_split = s.split
- pat = STR("--")
- for x in _RANGE_1000:
- s_split(pat)
- @bench(
- '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")',
- "split on multicharacter separator (small)", 1000)
- def rsplit_multichar_sep_small(STR):
- s = STR("this--is--a--test--of--the--emergency--broadcast--system")
- s_rsplit = s.rsplit
- pat = STR("--")
- for x in _RANGE_1000:
- s_rsplit(pat)
- ## split dna text on "ACTAT" characters
- @bench('dna.split("ACTAT")',
- "split on multicharacter separator (dna)", 10)
- def split_multichar_sep_dna(STR):
- s = _get_dna(STR)
- s_split = s.split
- pat = STR("ACTAT")
- for x in _RANGE_10:
- s_split(pat)
- @bench('dna.rsplit("ACTAT")',
- "split on multicharacter separator (dna)", 10)
- def rsplit_multichar_sep_dna(STR):
- s = _get_dna(STR)
- s_rsplit = s.rsplit
- pat = STR("ACTAT")
- for x in _RANGE_10:
- s_rsplit(pat)
- ## split with limits
- GFF3_example = "\t".join([
- "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".",
- "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"])
- @bench('GFF3_example.split("\\t")', "tab split", 1000)
- def tab_split_no_limit(STR):
- sep = STR("\t")
- s = STR(GFF3_example)
- s_split = s.split
- for x in _RANGE_1000:
- s_split(sep)
- @bench('GFF3_example.split("\\t", 8)', "tab split", 1000)
- def tab_split_limit(STR):
- sep = STR("\t")
- s = STR(GFF3_example)
- s_split = s.split
- for x in _RANGE_1000:
- s_split(sep, 8)
- @bench('GFF3_example.rsplit("\\t")', "tab split", 1000)
- def tab_rsplit_no_limit(STR):
- sep = STR("\t")
- s = STR(GFF3_example)
- s_rsplit = s.rsplit
- for x in _RANGE_1000:
- s_rsplit(sep)
- @bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000)
- def tab_rsplit_limit(STR):
- sep = STR("\t")
- s = STR(GFF3_example)
- s_rsplit = s.rsplit
- for x in _RANGE_1000:
- s_rsplit(sep, 8)
- #### Count characters
- @bench('...text.with.2000.newlines.count("\\n")',
- "count newlines", 10)
- def count_newlines(STR):
- s = _get_2000_lines(STR)
- s_count = s.count
- nl = STR("\n")
- for x in _RANGE_10:
- s_count(nl)
- # Orchid sequences concatenated, from Biopython
- _dna = """
- CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
- AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
- AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT
- TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC
- AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG
- TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
- CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
- TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
- GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC
- TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG
- GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA
- ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC
- CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA
- ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA
- ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA
- TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG
- CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG
- GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA
- ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG
- ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC
- ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA
- GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA
- TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG
- TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT
- TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG
- GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG
- GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT
- AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC
- GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG
- TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT
- CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA
- TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC
- TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC
- AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT
- GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT
- GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA
- CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG
- GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA
- TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG
- ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT
- GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA
- AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC
- AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA
- ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC
- GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC
- GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC
- AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA
- GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG
- ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC
- GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC
- """
- _dna = "".join(_dna.splitlines())
- _dna = _dna * 25
- _dna_bytes = bytes_from_str(_dna)
- _dna_unicode = unicode_from_str(_dna)
- def _get_dna(STR):
- if STR is UNICODE:
- return _dna_unicode
- if STR is BYTES:
- return _dna_bytes
- raise AssertionError
- @bench('dna.count("AACT")', "count AACT substrings in DNA example", 10)
- def count_aact(STR):
- seq = _get_dna(STR)
- seq_count = seq.count
- needle = STR("AACT")
- for x in _RANGE_10:
- seq_count(needle)
- ##### startswith and endswith
- @bench('"Andrew".startswith("A")', 'startswith single character', 1000)
- def startswith_single(STR):
- s1 = STR("Andrew")
- s2 = STR("A")
- s1_startswith = s1.startswith
- for x in _RANGE_1000:
- s1_startswith(s2)
- @bench('"Andrew".startswith("Andrew")', 'startswith multiple characters',
- 1000)
- def startswith_multiple(STR):
- s1 = STR("Andrew")
- s2 = STR("Andrew")
- s1_startswith = s1.startswith
- for x in _RANGE_1000:
- s1_startswith(s2)
- @bench('"Andrew".startswith("Anders")',
- 'startswith multiple characters - not!', 1000)
- def startswith_multiple_not(STR):
- s1 = STR("Andrew")
- s2 = STR("Anders")
- s1_startswith = s1.startswith
- for x in _RANGE_1000:
- s1_startswith(s2)
- # endswith
- @bench('"Andrew".endswith("w")', 'endswith single character', 1000)
- def endswith_single(STR):
- s1 = STR("Andrew")
- s2 = STR("w")
- s1_endswith = s1.endswith
- for x in _RANGE_1000:
- s1_endswith(s2)
- @bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000)
- def endswith_multiple(STR):
- s1 = STR("Andrew")
- s2 = STR("Andrew")
- s1_endswith = s1.endswith
- for x in _RANGE_1000:
- s1_endswith(s2)
- @bench('"Andrew".endswith("Anders")',
- 'endswith multiple characters - not!', 1000)
- def endswith_multiple_not(STR):
- s1 = STR("Andrew")
- s2 = STR("Anders")
- s1_endswith = s1.endswith
- for x in _RANGE_1000:
- s1_endswith(s2)
- #### Strip
- @bench('"Hello!\\n".strip()', 'strip terminal newline', 1000)
- def terminal_newline_strip_right(STR):
- s = STR("Hello!\n")
- s_strip = s.strip
- for x in _RANGE_1000:
- s_strip()
- @bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000)
- def terminal_newline_rstrip(STR):
- s = STR("Hello!\n")
- s_rstrip = s.rstrip
- for x in _RANGE_1000:
- s_rstrip()
- @bench('"\\nHello!".strip()', 'strip terminal newline', 1000)
- def terminal_newline_strip_left(STR):
- s = STR("\nHello!")
- s_strip = s.strip
- for x in _RANGE_1000:
- s_strip()
- @bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000)
- def terminal_newline_strip_both(STR):
- s = STR("\nHello!\n")
- s_strip = s.strip
- for x in _RANGE_1000:
- s_strip()
- @bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000)
- def terminal_newline_lstrip(STR):
- s = STR("\nHello!")
- s_lstrip = s.lstrip
- for x in _RANGE_1000:
- s_lstrip()
- @bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s',
- 'strip terminal newline', 1000)
- def terminal_newline_if_else(STR):
- s = STR("Hello!\n")
- NL = STR("\n")
- for x in _RANGE_1000:
- s[:-1] if (s[-1] == NL) else s
- # Strip multiple spaces or tabs
- @bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000)
- def terminal_space_strip(STR):
- s = STR("Hello\t \t!")
- s_strip = s.strip
- for x in _RANGE_1000:
- s_strip()
- @bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000)
- def terminal_space_rstrip(STR):
- s = STR("Hello!\t \t")
- s_rstrip = s.rstrip
- for x in _RANGE_1000:
- s_rstrip()
- @bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000)
- def terminal_space_lstrip(STR):
- s = STR("\t \tHello!")
- s_lstrip = s.lstrip
- for x in _RANGE_1000:
- s_lstrip()
- #### replace
- @bench('"This is a test".replace(" ", "\\t")', 'replace single character',
- 1000)
- def replace_single_character(STR):
- s = STR("This is a test!")
- from_str = STR(" ")
- to_str = STR("\t")
- s_replace = s.replace
- for x in _RANGE_1000:
- s_replace(from_str, to_str)
- @uses_re
- @bench('re.sub(" ", "\\t", "This is a test"', 'replace single character',
- 1000)
- def replace_single_character_re(STR):
- s = STR("This is a test!")
- pat = re.compile(STR(" "))
- to_str = STR("\t")
- pat_sub = pat.sub
- for x in _RANGE_1000:
- pat_sub(to_str, s)
- @bench('"...text.with.2000.lines...replace("\\n", " ")',
- 'replace single character, big string', 10)
- def replace_single_character_big(STR):
- s = _get_2000_lines(STR)
- from_str = STR("\n")
- to_str = STR(" ")
- s_replace = s.replace
- for x in _RANGE_10:
- s_replace(from_str, to_str)
- @uses_re
- @bench('re.sub("\\n", " ", "...text.with.2000.lines...")',
- 'replace single character, big string', 10)
- def replace_single_character_big_re(STR):
- s = _get_2000_lines(STR)
- pat = re.compile(STR("\n"))
- to_str = STR(" ")
- pat_sub = pat.sub
- for x in _RANGE_10:
- pat_sub(to_str, s)
- @bench('dna.replace("ATC", "ATT")',
- 'replace multiple characters, dna', 10)
- def replace_multiple_characters_dna(STR):
- seq = _get_dna(STR)
- from_str = STR("ATC")
- to_str = STR("ATT")
- seq_replace = seq.replace
- for x in _RANGE_10:
- seq_replace(from_str, to_str)
- # This increases the character count
- @bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")',
- 'replace and expand multiple characters, big string', 10)
- def replace_multiple_character_big(STR):
- s = _get_2000_lines(STR)
- from_str = STR("\n")
- to_str = STR("\r\n")
- s_replace = s.replace
- for x in _RANGE_10:
- s_replace(from_str, to_str)
- # This decreases the character count
- @bench('"When shall we three meet again?".replace("ee", "")',
- 'replace/remove multiple characters', 1000)
- def replace_multiple_character_remove(STR):
- s = STR("When shall we three meet again?")
- from_str = STR("ee")
- to_str = STR("")
- s_replace = s.replace
- for x in _RANGE_1000:
- s_replace(from_str, to_str)
- big_s = "A" + ("Z"*128*1024)
- big_s_bytes = bytes_from_str(big_s)
- big_s_unicode = unicode_from_str(big_s)
- def _get_big_s(STR):
- if STR is UNICODE: return big_s_unicode
- if STR is BYTES: return big_s_bytes
- raise AssertionError
- # The older replace implementation counted all matches in
- # the string even when it only needed to make one replacement.
- @bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)',
- 'quick replace single character match', 10)
- def quick_replace_single_match(STR):
- s = _get_big_s(STR)
- from_str = STR("A")
- to_str = STR("BB")
- s_replace = s.replace
- for x in _RANGE_10:
- s_replace(from_str, to_str, 1)
- @bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)',
- 'quick replace multiple character match', 10)
- def quick_replace_multiple_match(STR):
- s = _get_big_s(STR)
- from_str = STR("AZZ")
- to_str = STR("BBZZ")
- s_replace = s.replace
- for x in _RANGE_10:
- s_replace(from_str, to_str, 1)
- ####
- # CCP does a lot of this, for internationalisation of ingame messages.
- _format = "The %(thing)s is %(place)s the %(location)s."
- _format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", }
- _format_bytes = bytes_from_str(_format)
- _format_unicode = unicode_from_str(_format)
- _format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items())
- _format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items())
- def _get_format(STR):
- if STR is UNICODE:
- return _format_unicode
- if STR is BYTES:
- if sys.version_info >= (3,):
- raise UnsupportedType
- return _format_bytes
- raise AssertionError
- def _get_format_dict(STR):
- if STR is UNICODE:
- return _format_dict_unicode
- if STR is BYTES:
- if sys.version_info >= (3,):
- raise UnsupportedType
- return _format_dict_bytes
- raise AssertionError
- # Formatting.
- @bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}',
- 'formatting a string type with a dict', 1000)
- def format_with_dict(STR):
- s = _get_format(STR)
- d = _get_format_dict(STR)
- for x in _RANGE_1000:
- s % d
- #### Upper- and lower- case conversion
- @bench('("Where in the world is Carmen San Deigo?"*10).lower()',
- "case conversion -- rare", 1000)
- def lower_conversion_rare(STR):
- s = STR("Where in the world is Carmen San Deigo?"*10)
- s_lower = s.lower
- for x in _RANGE_1000:
- s_lower()
- @bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()',
- "case conversion -- dense", 1000)
- def lower_conversion_dense(STR):
- s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10)
- s_lower = s.lower
- for x in _RANGE_1000:
- s_lower()
- @bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()',
- "case conversion -- rare", 1000)
- def upper_conversion_rare(STR):
- s = STR("Where in the world is Carmen San Deigo?"*10)
- s_upper = s.upper
- for x in _RANGE_1000:
- s_upper()
- @bench('("where in the world is carmen san deigo?"*10).upper()',
- "case conversion -- dense", 1000)
- def upper_conversion_dense(STR):
- s = STR("where in the world is carmen san deigo?"*10)
- s_upper = s.upper
- for x in _RANGE_1000:
- s_upper()
- # end of benchmarks
- #################
- class BenchTimer(timeit.Timer):
- def best(self, repeat=1):
- for i in range(1, 10):
- number = 10**i
- x = self.timeit(number)
- if x > 0.02:
- break
- times = [x]
- for i in range(1, repeat):
- times.append(self.timeit(number))
- return min(times) / number
- def main():
- (options, test_names) = parser.parse_args()
- if options.bytes_only and options.unicode_only:
- raise SystemExit("Only one of --8-bit and --unicode are allowed")
- bench_functions = []
- for (k,v) in globals().items():
- if hasattr(v, "is_bench"):
- if test_names:
- for name in test_names:
- if name in v.group:
- break
- else:
- # Not selected, ignore
- continue
- if options.skip_re and hasattr(v, "uses_re"):
- continue
- bench_functions.append( (v.group, k, v) )
- bench_functions.sort()
- p("bytes\tunicode")
- p("(in ms)\t(in ms)\t%\tcomment")
- bytes_total = uni_total = 0.0
- for title, group in itertools.groupby(bench_functions,
- operator.itemgetter(0)):
- # Flush buffer before each group
- sys.stdout.flush()
- p("="*10, title)
- for (_, k, v) in group:
- if hasattr(v, "is_bench"):
- bytes_time = 0.0
- bytes_time_s = " - "
- if not options.unicode_only:
- try:
- bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,),
- "import __main__").best(REPEAT)
- bytes_time_s = "%.2f" % (1000 * bytes_time)
- bytes_total += bytes_time
- except UnsupportedType:
- bytes_time_s = "N/A"
- uni_time = 0.0
- uni_time_s = " - "
- if not options.bytes_only:
- try:
- uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,),
- "import __main__").best(REPEAT)
- uni_time_s = "%.2f" % (1000 * uni_time)
- uni_total += uni_time
- except UnsupportedType:
- uni_time_s = "N/A"
- try:
- average = bytes_time/uni_time
- except (TypeError, ZeroDivisionError):
- average = 0.0
- p("%s\t%s\t%.1f\t%s (*%d)" % (
- bytes_time_s, uni_time_s, 100.*average,
- v.comment, v.repeat_count))
- if bytes_total == uni_total == 0.0:
- p("That was zippy!")
- else:
- try:
- ratio = bytes_total/uni_total
- except ZeroDivisionError:
- ratio = 0.0
- p("%.2f\t%.2f\t%.1f\t%s" % (
- 1000*bytes_total, 1000*uni_total, 100.*ratio,
- "TOTAL"))
- if __name__ == "__main__":
- main()