/test/unit/bio/appl/sim4/test_report.rb
https://github.com/domthu/bioruby · Ruby · 870 lines · 682 code · 173 blank · 15 comment · 0 complexity · 1a684e656b202cd3fc8cd7371be06cdd MD5 · raw file
- #
- # test/unit/bio/appl/sim4/test_report.rb - Unit test for Bio::Sim4
- #
- # Copyright:: Copyright (C) 2009
- # Naohisa Goto <ng@bioruby.org>
- # License:: The Ruby License
- #
- # $Id:$
- #
- # loading helper routine for testing bioruby
- require 'pathname'
- load Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4,
- 'bioruby_test_helper.rb')).cleanpath.to_s
- # libraries needed for the tests
- require 'test/unit'
- require 'bio/appl/sim4/report'
- module Bio
- class TestDataForSim4Report
- DataPath = Pathname.new(File.join(BioRubyTestDataPath, 'sim4')).cleanpath.to_s
- def initialize(filename)
- @filename = filename
- end
- def read
- File.read(File.join(DataPath,@filename))
- end
- def report
- Bio::Sim4::Report.new(self.read)
- end
- def self.report(filename)
- self.new(filename).report
- end
- def self.report1
- filename = "simple-A4.sim4"
- self.new(filename).report
- end
- def self.report2
- filename = "simple2-A4.sim4"
- self.new(filename).report
- end
- def self.report4
- filename = "complement-A4.sim4"
- self.new(filename).report
- end
- end #class TestDataForSim4Report
- class TestSim4Report < Test::Unit::TestCase
- def setup
- @sim4 = TestDataForSim4Report.report1
- end
- def test_hits
- assert_kind_of(Array, @sim4.hits)
- assert_equal(1, @sim4.hits.size)
- assert_instance_of(Bio::Sim4::Report::Hit, @sim4.hits[0])
- end
- def test_all_hits
- assert_kind_of(Array, @sim4.all_hits)
- assert_equal(1, @sim4.all_hits.size)
- assert_instance_of(Bio::Sim4::Report::Hit, @sim4.all_hits[0])
- end
- def exec_test_seq1_len(sd)
- assert_equal(94, sd.len)
- end
- private :exec_test_seq1_len
- def test_seq1
- sd = @sim4.seq1
- assert_instance_of(Bio::Sim4::Report::SeqDesc, sd)
- assert_equal('mrna1', sd.entry_id)
- assert_equal('mrna1', sd.definition)
- assert_equal('sample10-1.fst', sd.filename)
- exec_test_seq1_len(sd)
- end
- def exec_test_each(meth)
- count = 0
- assert_nothing_raised {
- @sim4.__send__(meth) do |x|
- count += 1
- end
- }
- assert_equal(1, count)
- @sim4.__send__(meth) do |x|
- assert_instance_of(Bio::Sim4::Report::Hit, x)
- end
- end
- private :exec_test_each
- def test_each
- exec_test_each(:each)
- end
- def test_each_hit
- exec_test_each(:each_hit)
- end
- def test_num_hits
- assert_equal(1, @sim4.num_hits)
- end
- def test_query_def
- assert_equal('mrna1', @sim4.query_def)
- end
- def test_query_id
- assert_equal('mrna1', @sim4.query_id)
- end
- def test_query_len
- assert_equal(94, @sim4.query_len)
- end
- end #class TestSim4Report
- class TestSim4ReportHit < Test::Unit::TestCase
- def setup
- @hit = TestDataForSim4Report.report1.hits.first
- end
- def test_align
- a = [
- [ "TTGTTTCCGTCGCTGGTTATTGTCTAGAACGCAAAAATAG",
- "||||||||||||||||||||||||||||||||||||||||",
- "TTGTTTCCGTCGCTGGTTATTGTCTAGAACGCAAAAATAG" ],
- [ " ",
- "<<<...<<<",
- "CTG...TAC" ],
- [ "TCTACACATCACTAGCGTGGGTGGGCGGAAAGAGCAGCTCGCCACT CAAGCTAA",
- "|||||||||||||||| |||||||||||||-|||||||||||||||-||||||||",
- "TCTACACATCACTAGCCTGGGTGGGCGGAA GAGCAGCTCGCCACTTCAAGCTAA" ]
- ]
- assert_equal(a, @hit.align)
- end
- def test_complement?
- assert_equal(nil, @hit.complement?)
- end
- def test_definition
- assert_equal('genome1', @hit.definition)
- end
- def test_each
- count = 0
- assert_nothing_raised {
- @hit.each do |x|
- count += 1
- end
- }
- assert_equal(2, count)
- @hit.each do |x|
- assert_instance_of(Bio::Sim4::Report::SegmentPair, x)
- end
- end
- def exec_test_exons(meth)
- assert_kind_of(Array, @hit.__send__(meth))
- assert_equal(2, @hit.__send__(meth).size)
- @hit.__send__(meth).each do |x|
- assert_instance_of(Bio::Sim4::Report::SegmentPair, x)
- end
- end
- private :exec_test_exons
- def test_exons
- exec_test_exons(:exons)
- end
- def test_hit_id
- assert_equal('genome1', @hit.hit_id)
- end
- def test_hsps
- exec_test_exons(:hsps)
- end
- def test_introns
- assert_kind_of(Array, @hit.introns)
- assert_equal(1, @hit.introns.size)
- @hit.introns.each do |x|
- assert_instance_of(Bio::Sim4::Report::SegmentPair, x)
- end
- end
- def test_len
- assert_equal(599, @hit.len)
- end
- def test_query_def
- assert_equal('mrna1', @hit.query_def)
- end
- def test_query_id
- assert_equal('mrna1', @hit.query_id)
- end
- def test_query_len
- assert_equal(94, @hit.query_len)
- end
- def test_segmentpairs
- assert_kind_of(Array, @hit.segmentpairs)
- assert_equal(3, @hit.segmentpairs.size)
- @hit.segmentpairs.each do |x|
- assert_instance_of(Bio::Sim4::Report::SegmentPair, x)
- end
- end
- def exec_test_seq1_len(sd)
- assert_equal(94, sd.len)
- end
- private :exec_test_seq1_len
- def test_seq1
- sd = @hit.seq1
- assert_instance_of(Bio::Sim4::Report::SeqDesc, sd)
- assert_equal('mrna1', sd.entry_id)
- assert_equal('mrna1', sd.definition)
- assert_equal('sample10-1.fst', sd.filename)
- exec_test_seq1_len(sd)
- end
- def test_seq2
- sd = @hit.seq2
- assert_instance_of(Bio::Sim4::Report::SeqDesc, sd)
- assert_equal('genome1', sd.entry_id)
- assert_equal('genome1', sd.definition)
- assert_equal(599, sd.len)
- #assert_equal('sample10-2.fst', sd.filename)
- assert_equal('sample10-2.fst (genome1)', sd.filename)
- end
- def test_target_def
- assert_equal('genome1', @hit.target_def)
- end
- def test_target_id
- assert_equal('genome1', @hit.target_id)
- end
- def test_target_len
- assert_equal(599, @hit.target_len)
- end
- end #class TestSim4ReportHit
- class TestSim4ReportSegmentPair_exon < Test::Unit::TestCase
- def setup
- @exon = TestDataForSim4Report.report1.hits[0].exons[1]
- end
- def test_align_len
- assert_equal(55, @exon.align_len)
- end
- def test_direction
- assert_equal("", @exon.direction)
- end
- def test_hit_from
- assert_equal(404, @exon.hit_from)
- end
- def test_hit_to
- assert_equal(457, @exon.hit_to)
- end
- def test_hseq
- hseq = "TCTACACATCACTAGCCTGGGTGGGCGGAA GAGCAGCTCGCCACTTCAAGCTAA"
- assert_equal(hseq, @exon.hseq)
- end
- def test_midline
- midline = "|||||||||||||||| |||||||||||||-|||||||||||||||-||||||||"
- assert_equal(midline, @exon.midline)
- end
- def test_percent_identity
- #assert_equal(94, @exon.percent_identity)
- assert_equal("94", @exon.percent_identity)
- end
- def test_qseq
- qseq = "TCTACACATCACTAGCGTGGGTGGGCGGAAAGAGCAGCTCGCCACT CAAGCTAA"
- assert_equal(qseq, @exon.qseq)
- end
- def test_query_from
- assert_equal(41, @exon.query_from)
- end
- def test_query_to
- assert_equal(94, @exon.query_to)
- end
- def exec_test_seq1_from_to(seg)
- assert_equal(41, seg.from)
- assert_equal(94, seg.to)
- end
- private :exec_test_seq1_from_to
- def test_seq1
- assert_instance_of(Bio::Sim4::Report::Segment, @exon.seq1)
- assert_equal("TCTACACATCACTAGCGTGGGTGGGCGGAAAGAGCAGCTCGCCACT CAAGCTAA",
- @exon.seq1.seq)
- exec_test_seq1_from_to(@exon.seq1)
- end
- def test_seq2
- assert_instance_of(Bio::Sim4::Report::Segment, @exon.seq2)
- assert_equal(404, @exon.seq2.from)
- assert_equal(457, @exon.seq2.to)
- assert_equal("TCTACACATCACTAGCCTGGGTGGGCGGAA GAGCAGCTCGCCACTTCAAGCTAA",
- @exon.seq2.seq)
- end
- end #class TestSim4ReportSegmentPair_exon
- class TestSim4ReportSegmentPair_intron < Test::Unit::TestCase
- def setup
- @intron = TestDataForSim4Report.report1.hits[0].introns[0]
- end
- def test_align_len
- assert_equal(9, @intron.align_len)
- end
- def test_direction
- assert_equal(nil, @intron.direction)
- end
- def test_hit_from
- assert_equal(185, @intron.hit_from)
- end
- def test_hit_to
- assert_equal(403, @intron.hit_to)
- end
- def test_hseq
- hseq = "CTG...TAC"
- assert_equal(hseq, @intron.hseq)
- end
- def test_midline
- midline = "<<<...<<<"
- assert_equal(midline, @intron.midline)
- end
- def test_percent_identity
- assert_equal(nil, @intron.percent_identity)
- end
- def test_qseq
- qseq = " "
- assert_equal(qseq, @intron.qseq)
- end
- def test_query_from
- assert_equal(0, @intron.query_from)
- end
- def test_query_to
- assert_equal(0, @intron.query_to)
- end
- def test_seq1
- assert_instance_of(Bio::Sim4::Report::Segment, @intron.seq1)
- assert_equal(0, @intron.seq1.from)
- assert_equal(0, @intron.seq1.to)
- assert_equal(" ", @intron.seq1.seq)
- end
- def test_seq2
- assert_instance_of(Bio::Sim4::Report::Segment, @intron.seq2)
- assert_equal(185, @intron.seq2.from)
- assert_equal(403, @intron.seq2.to)
- assert_equal("CTG...TAC", @intron.seq2.seq)
- end
- end #class TestSim4ReportSegmentPair_intron
- class TestSim4Report2 < TestSim4Report
- def setup
- @sim4 = TestDataForSim4Report.report2
- end
- def test_query_len
- assert_equal(96, @sim4.query_len)
- end
- def exec_test_seq1_len(sd)
- assert_equal(96, sd.len)
- end
- private :exec_test_seq1_len
- end #class TestSim4Report2
- class TestSim4ReportHit2 < TestSim4ReportHit
- def setup
- @hit = TestDataForSim4Report.report2.hits.first
- end
- def test_align
- a = [
- [ "AGTTGTTTCCGTCGCTGGTTATTGTCTAGAACGCAAAAATAG",
- "||||||||||||||||||||||||||||||||||||||||||",
- "AGTTGTTTCCGTCGCTGGTTATTGTCTAGAACGCAAAAATAG" ],
- [ " ",
- "<<<...<<<",
- "CTG...TAC" ],
- [ "TCTACACATCACTAGCGTGGGTGGGCGGAAAGAGCAGCTCGCCACT CAAGCTAA",
- "|||||||||||||||| |||||||||||||-|||||||||||||||-||||||||",
- "TCTACACATCACTAGCCTGGGTGGGCGGAA GAGCAGCTCGCCACTTCAAGCTAA" ]
- ]
- assert_equal(a, @hit.align)
- end
- def test_query_len
- assert_equal(96, @hit.query_len)
- end
- def exec_test_seq1_len(sd)
- assert_equal(96, sd.len)
- end
- private :exec_test_seq1_len
- end #class TestSim4ReportHit2
- class TestSim4ReportSegmentPair2_exon < TestSim4ReportSegmentPair_exon
- def setup
- @exon = TestDataForSim4Report.report2.hits[0].exons[1]
- end
- def test_query_from
- assert_equal(43, @exon.query_from)
- end
- def test_query_to
- assert_equal(96, @exon.query_to)
- end
- def exec_test_seq1_from_to(seg)
- assert_equal(43, seg.from)
- assert_equal(96, seg.to)
- end
- private :exec_test_seq1_from_to
- end #class TestSim4ReportSegmentPair2_exon
- class TestSim4ReportSegmentPair2_intron < TestSim4ReportSegmentPair_intron
- def setup
- @intron = TestDataForSim4Report.report2.hits[0].introns[0]
- end
- end #class TestSim4ReportSegmentPair2_intron
- class TestSim4Report4 < TestSim4Report
- def setup
- @sim4 = TestDataForSim4Report.report4
- end
- def exec_test_seq1_len(sd)
- assert_equal(284, sd.len)
- end
- private :exec_test_seq1_len
- def test_seq1
- sd = @sim4.seq1
- assert_instance_of(Bio::Sim4::Report::SeqDesc, sd)
- assert_equal('mrna4c', sd.entry_id)
- assert_equal('mrna4c', sd.definition)
- assert_equal('sample41-1c.fst', sd.filename)
- exec_test_seq1_len(sd)
- end
- def test_query_def
- assert_equal('mrna4c', @sim4.query_def)
- end
- def test_query_id
- assert_equal('mrna4c', @sim4.query_id)
- end
- def test_query_len
- assert_equal(284, @sim4.query_len)
- end
- end #class TestSim4Report4
- class TestSim4ReportHit4 < TestSim4ReportHit
- def setup
- @hit = TestDataForSim4Report.report4.hits.first
- end
- def test_align
- a = [
- [ "TTTTAGCCGGCACGAGATTG AGCGTATGATCACGCGCGCGGCCTCCT CAGAGTGATGCATGATACAACTT AT ",
- "||||||||||||||||||||-||||-||||||||||||||||||||||-|-|||| ||||||||||||||||- |-",
- "TTTTAGCCGGCACGAGATTGCAGCG ATGATCACGCGCGCGGCCTCCTAC GAGTCATGCATGATACAACTTCTTG"],
- [ " ",
- ">>>...>>>",
- "GTT...GAT" ],
- [ "ATATGTACTTAGCTGGCAACCGAGATTTACTTTCGAAGCACTGTGATGAACCCGCGGCCCTTTGAGCGCT",
- "|||||||||||||-|||||||||||||||||||||||| |||||||||||||||||-|||||||||||||",
- "ATATGTACTTAGC GGCAACCGAGATTTACTTTCGAAGGACTGTGATGAACCCGCG CCCTTTGAGCGCT" ],
- [ "", "", "" ],
- [ "TATATATGTACTTAGCGG ACACCGAGATTTACTTTCGAAGGACTGTGGATGAACCCGCGCCCTTTGAGCGCT",
- "||||||||||||||||||-|-|||||||||||||||||||||||||||-||||||||||||||||||||||||",
- "TATATATGTACTTAGCGGCA ACCGAGATTTACTTTCGAAGGACTGTG ATGAACCCGCGCCCTTTGAGCGCT" ]
- ]
- assert_equal(a, @hit.align)
- end
- def test_complement?
- assert_equal(true, @hit.complement?)
- end
- def test_definition
- assert_equal('genome4', @hit.definition)
- end
- def test_each
- count = 0
- assert_nothing_raised {
- @hit.each do |x|
- count += 1
- end
- }
- assert_equal(3, count)
- @hit.each do |x|
- assert_instance_of(Bio::Sim4::Report::SegmentPair, x)
- end
- end
- def exec_test_exons(meth)
- assert_kind_of(Array, @hit.__send__(meth))
- assert_equal(3, @hit.__send__(meth).size)
- @hit.__send__(meth).each do |x|
- assert_instance_of(Bio::Sim4::Report::SegmentPair, x)
- end
- end
- private :exec_test_exons
- def test_hit_id
- assert_equal('genome4', @hit.hit_id)
- end
- def test_introns
- assert_kind_of(Array, @hit.introns)
- assert_equal(2, @hit.introns.size)
- @hit.introns.each do |x|
- assert_instance_of(Bio::Sim4::Report::SegmentPair, x)
- end
- end
- def test_len
- assert_equal(770, @hit.len)
- end
- def test_query_def
- assert_equal('mrna4c', @hit.query_def)
- end
- def test_query_id
- assert_equal('mrna4c', @hit.query_id)
- end
- def test_query_len
- assert_equal(284, @hit.query_len)
- end
- def test_segmentpairs
- assert_kind_of(Array, @hit.segmentpairs)
- assert_equal(5, @hit.segmentpairs.size)
- @hit.segmentpairs.each do |x|
- assert_instance_of(Bio::Sim4::Report::SegmentPair, x)
- end
- end
- def exec_test_seq1_len(sd)
- assert_equal(284, sd.len)
- end
- private :exec_test_seq1_len
- def test_seq1
- sd = @hit.seq1
- assert_instance_of(Bio::Sim4::Report::SeqDesc, sd)
- assert_equal('mrna4c', sd.entry_id)
- assert_equal('mrna4c', sd.definition)
- assert_equal('sample41-1c.fst', sd.filename)
- exec_test_seq1_len(sd)
- end
- def test_seq2
- sd = @hit.seq2
- assert_instance_of(Bio::Sim4::Report::SeqDesc, sd)
- assert_equal('genome4', sd.entry_id)
- assert_equal('genome4', sd.definition)
- assert_equal(770, sd.len)
- #assert_equal('sample40-2.fst', sd.filename)
- assert_equal('sample40-2.fst (genome4)', sd.filename)
- end
- def test_target_def
- assert_equal('genome4', @hit.target_def)
- end
- def test_target_id
- assert_equal('genome4', @hit.target_id)
- end
- def test_target_len
- assert_equal(770, @hit.target_len)
- end
- end #class TestSim4ReportHit4
- class TestSim4ReportSegmentPair4_exon < TestSim4ReportSegmentPair_exon
- def setup
- @exon = TestDataForSim4Report.report4.hits[0].exons[1]
- end
- def test_align_len
- assert_equal(70, @exon.align_len)
- end
- def test_direction
- assert_equal("==", @exon.direction)
- end
- def test_hit_from
- assert_equal(563, @exon.hit_from)
- end
- def test_hit_to
- assert_equal(630, @exon.hit_to)
- end
- def test_hseq
- hseq = "ATATGTACTTAGC GGCAACCGAGATTTACTTTCGAAGGACTGTGATGAACCCGCG CCCTTTGAGCGCT"
- assert_equal(hseq, @exon.hseq)
- end
- def test_midline
- midline = "|||||||||||||-|||||||||||||||||||||||| |||||||||||||||||-|||||||||||||"
- assert_equal(midline, @exon.midline)
- end
- def test_percent_identity
- #assert_equal(95, @exon.percent_identity)
- assert_equal("95", @exon.percent_identity)
- end
- def test_qseq
- qseq = "ATATGTACTTAGCTGGCAACCGAGATTTACTTTCGAAGCACTGTGATGAACCCGCGGCCCTTTGAGCGCT"
- assert_equal(qseq, @exon.qseq)
- end
- def test_query_from
- assert_equal(73, @exon.query_from)
- end
- def test_query_to
- assert_equal(142, @exon.query_to)
- end
- def exec_test_seq1_from_to(seg)
- assert_equal(73, seg.from)
- assert_equal(142, seg.to)
- end
- private :exec_test_seq1_from_to
- def test_seq1
- assert_instance_of(Bio::Sim4::Report::Segment, @exon.seq1)
- assert_equal("ATATGTACTTAGCTGGCAACCGAGATTTACTTTCGAAGCACTGTGATGAACCCGCGGCCCTTTGAGCGCT",
- @exon.seq1.seq)
- exec_test_seq1_from_to(@exon.seq1)
- end
- def test_seq2
- assert_instance_of(Bio::Sim4::Report::Segment, @exon.seq2)
- assert_equal(563, @exon.seq2.from)
- assert_equal(630, @exon.seq2.to)
- assert_equal("ATATGTACTTAGC GGCAACCGAGATTTACTTTCGAAGGACTGTGATGAACCCGCG CCCTTTGAGCGCT",
- @exon.seq2.seq)
- end
- end #class TestSim4ReportSegmentPair4_exon
- class TestSim4ReportSegmentPair4_intron < TestSim4ReportSegmentPair_intron
- def setup
- @intron = TestDataForSim4Report.report4.hits[0].introns[0]
- end
- def test_hit_from
- assert_equal(425, @intron.hit_from)
- end
- def test_hit_to
- assert_equal(562, @intron.hit_to)
- end
- def test_hseq
- hseq = "GTT...GAT"
- assert_equal(hseq, @intron.hseq)
- end
- def test_midline
- midline = ">>>...>>>"
- assert_equal(midline, @intron.midline)
- end
- def test_seq2
- assert_instance_of(Bio::Sim4::Report::Segment, @intron.seq2)
- assert_equal(425, @intron.seq2.from)
- assert_equal(562, @intron.seq2.to)
- assert_equal("GTT...GAT", @intron.seq2.seq)
- end
- end #class TestSim4ReportSegmentPair4_intron
- class TestSim4ReportSegmentPair4_intron1 < Test::Unit::TestCase
- def setup
- @intron = TestDataForSim4Report.report4.hits[0].introns[1]
- end
- def test_align_len
- assert_equal(0, @intron.align_len)
- end
- def test_direction
- assert_equal(nil, @intron.direction)
- end
- def test_hit_from
- assert_equal(631, @intron.hit_from)
- end
- def test_hit_to
- assert_equal(699, @intron.hit_to)
- end
- def test_hseq
- assert_equal("", @intron.hseq)
- end
- def test_midline
- assert_equal("", @intron.midline)
- end
- def test_percent_identity
- assert_equal(nil, @intron.percent_identity)
- end
- def test_qseq
- assert_equal("", @intron.qseq)
- end
- def test_query_from
- assert_equal(143, @intron.query_from)
- end
- def test_query_to
- assert_equal(212, @intron.query_to)
- end
- def test_seq1
- assert_instance_of(Bio::Sim4::Report::Segment, @intron.seq1)
- assert_equal(143, @intron.seq1.from)
- assert_equal(212, @intron.seq1.to)
- assert_equal("", @intron.seq1.seq)
- end
- def test_seq2
- assert_instance_of(Bio::Sim4::Report::Segment, @intron.seq2)
- assert_equal(631, @intron.seq2.from)
- assert_equal(699, @intron.seq2.to)
- assert_equal("", @intron.seq2.seq)
- end
- end #class TestSim4ReportSegmentPair4_intron1
- class TestSim4ReportSeqDesc < Test::Unit::TestCase
- def setup
- @str1 = 'seq1 = c_NC_000011.5_101050001-101075000.fst, 25000 bp'
- @str2 = '>ref|NC_000011.5|NC_000011:c101075000-101050001 Homo sapiens chromosome 11, complete sequence'
- @seqdesc = Bio::Sim4::Report::SeqDesc.parse(@str1, @str2)
- end
- def test_entry_id
- assert_equal('ref|NC_000011.5|NC_000011:c101075000-101050001',
- @seqdesc.entry_id)
- end
- def test_definition
- assert_equal("ref|NC_000011.5|NC_000011:c101075000-101050001 Homo sapiens chromosome 11, complete sequence",
- @seqdesc.definition)
- end
- def test_len
- assert_equal(25000, @seqdesc.len)
- end
- def test_filename
- assert_equal('c_NC_000011.5_101050001-101075000.fst', @seqdesc.filename)
- end
- def test_self_parse
- assert_instance_of(Bio::Sim4::Report::SeqDesc,
- Bio::Sim4::Report::SeqDesc.parse(@str1, @str2))
- assert_instance_of(Bio::Sim4::Report::SeqDesc,
- Bio::Sim4::Report::SeqDesc.parse(@str1))
- end
- def test_self_new
- assert_instance_of(Bio::Sim4::Report::SeqDesc,
- Bio::Sim4::Report::SeqDesc.new('SEQID',
- 'SEQDEF',
- 123,
- 'file.sim4'))
- end
- end #class TestSim4ReportSeqDesc
- class TestSim4ReportSegment < Test::Unit::TestCase
- def setup
- @seq = "TCTACACATCACTAGCGTGGGTGGGCGGAAAGAGCAGCTCGCCACT CAAGCTAA".freeze
- @segment = Bio::Sim4::Report::Segment.new("123", "176", @seq.dup)
- end
- def test_from
- assert_equal(123, @segment.from)
- end
- def test_to
- assert_equal(176, @segment.to)
- end
- def test_seq
- assert_equal(@seq, @segment.seq)
- end
- def test_self_new
- assert_instance_of(Bio::Sim4::Report::Segment,
- Bio::Sim4::Report::Segment.new(1,9))
- assert_instance_of(Bio::Sim4::Report::Segment,
- Bio::Sim4::Report::Segment.new(2,4, "ATG"))
- end
- end #class TestSim4ReportSegment
- end #module Bio