PageRenderTime 89ms CodeModel.GetById 4ms app.highlight 9ms RepoModel.GetById 1ms app.codeStats 1ms

/test-data/velvet_test_reference.fa

https://bitbucket.org/cistrome/cistrome-harvard/
Unknown | 1668 lines | 1668 code | 0 blank | 0 comment | 0 complexity | b50df57fb9773d7628e17f0fed1add42 MD5 | raw file
   1> SEQUENCE 0 100000
   2CTATTTATGCCGTTGGCCACGAATTCAGAATCATATTAGCCTAATGTATTCCACATTCCT
   3CACCACATGTATGAACTTGGGTAGCAGACTTTAAAAGCTAATTGATATGGCCCCTGGCGT
   4CGGCGTCAAAAATAGTTGGGAATGCGATATTCCCGTATAATAAGATGACAGGACAGTACT
   5TAAAGGAGCATAATTCGCCACTGGAGATGCTGGTGAGGGTGCATCTATACTCACTATTTG
   6CGATGGTACCTTTTGAGGTGTTATATTATTGACGTTAGTCTTCGGTGCGGTCCTCCTACG
   7TTGCCCAGTATGTACCATGGCGTGCAAACCGACACGCGAAGATCAAGATCGCTGTAGTCT
   8CTAGACACTCGCCCGCCCGAGACCGCCCAGACGATGGATCCCTGGCTTGCAAGCCAGTCT
   9CGATGACAACGCGCTCGGACAACGGTGAGATTGATAAACACTCAAACGGCTGGCAAATAG
  10TACCAACACGAGCCGCCTATCTGTAGTACTGATACTATTCCTATAGACGACTATGACCCT
  11ATTATCTAATCCGCATACAGCCCCATGGATCAGAAGCAGCTTTCCTACACTGGATTTCCT
  12AGTTGACAATCTGAATACAAGTGATGTGTACAGCTCCACCTGACTACTCCTTCGAAATTT
  13AATGCGTGGATCTTTGAACCCACGGCTGAGGAGCTAAGGGTGAGCTACTCTACATACGGC
  14AAGGGCGGTCAGTAAATAGGCCTTCGTGACTAGCGAGCGGGGACTCCGCTCTAAGCGCTG
  15GTGAAAATCGCTCCAAGGGACTTGTCTCGTTAGCCGGCCTAGTCATCGCTGTTCCGGAAA
  16TTCCCGATTCGTACAACCGGCCCAGGGCTGCGGGATAAGACATCGACTCACGCTGTCCAA
  17TGTCATACTGCATAGCATAGTCAAATAGAAGTGCCTACATACATCGAGCAACCACGTCAT
  18GGTAAATACTACAAAGGAATAAAGAGAATATCGGGGGCTACTCCTGTCGTATTCCATCAG
  19CTATGGGATCAAAGGTACAGCACACGAATATAATAGCGGATTCTCTGCAGTCGCGATGAT
  20TTTTGTCTCTAAGCTTACAATAGGCAGAGGTCGTAAGCAACAATCATCCTCCTTTATCCG
  21TATCTAGGCGGGGGGTGCAAACCACAAACCGAGGGCGATTGCGAAATGCTGCATCCTGGA
  22TACCGTTATGACAGCAGAGTTCATAGCAATATTCCGAAGTGGAGACGGCCCAGGAGACGA
  23ATTTAACCAAATGCCTGACACTATCACCCACCTACTCGACGCACGGAAGCATACGCCTGT
  24TTAGACGCAGGGTTTCCTGTCGGCTATCTCATCACCGTGGGAACTATATCTATCGTCCAC
  25GAATACAGCGATTCAGCTTAAGCAATTCATGGTGGTAGGCCGAATAGAACCAAGAACTCC
  26GATCGCCGATTCCTCCATCACGACACCCAGGTGGACTCTTATAGGCTGCAGGTTTTAACA
  27GTTCCAGCCCAGACATGTCTTACGTAGTATTTGTAATGCATCGAGGTCCAACAGTTGCGT
  28AGGTCGTAAAATCTTACGCTTCATTTTGCCCCTTAACTACTCACAACCGGACTACTAACC
  29CGGCCTCGGGTGTTTTTAAGGCTCCAACACGGTCTAAAGGGCACCTAATCGCGGTTGTCT
  30CTCAAACAATTTCTAGTCGGGCAATTTCGAATACAACCCGAACCTCTGGGCATCAGAATG
  31AAGACGCTTGCTGGCCTAAGGCGCGTTGTTATTGAAACTTTATCGAGGAGATTGACCATA
  32TAAGGAGTCGGAGCCCCTTGGTCCCCTTCGTAGTGCTCAATGACACGCCCTTAAAGGTCT
  33GAAAAGCTTCAGAAAAGGCTACGACGGTGTTAATAACGTCTTTTATTGGCCGGTGTCCTT
  34AGTACAAGGATCTTCTGACACGGTCCTTGGGGAGTCGTTATTCTGGGATACAGTAAATTG
  35CCCCTAGCTCCTATGGCATAAACTTCTAAGGCTTGTTAATCGGGCAAGATTCTAATCTTC
  36CCGACATAAATCGCTTCACGTATTATGCGCGTGATTATAATTGCCCAGCCACGTAGGGAA
  37TGTCTTCTGCACAGGCTGACTAGCAGAGAATTGGACCCCTGCATTGAGAATACCCCTCTT
  38CGGACTCGAGGTTGGGCGCCTACAGTCCAACGTTGAGTGTGAGCTAAAGCCCCTCTGGCG
  39TGAGCGGAGATACCCACCATGCCAAGTGCACAGCGAAAAGATGCATCCCCATTCTTATGC
  40TTCGATGATGGTCACCAGGCAGATAAGATACGTGAACGAAATTCTAGTTAATTCGTCATA
  41CAGAGTATCCTGAGTTTGTGGTCCATACTTCATACCTCAAGTGGGGGCACTGAAACTAGG
  42AATTAACTCCTACGGTAAAACTGGTGTGTCATCTGCTTACCACGGTCGACGCAATTTGCG
  43ACCCCTTATTCATGGCGTTGACTAGTTCCATCCATGTGTGCAGCTAGCTGTTTGTCCGGT
  44GCAACTGCCCTTGGACGGGGACCATCCCTAAGCAGTAAACGTAACACATTGTATTTACAA
  45CAGGCACCACGGCTGGTTGGGAGGACGAGGATTGGAGTCTCTCGGAAGTTAGTGATAGAG
  46CAGATAACTCAAAGGTGTCCGCTCAACAGCGTCATAATGAAGACATAGGCAAGTCGTGGG
  47TCCCCCCGATGCGGGGCGCTTCTCACAATGGTTTACACTCCCGTTACCGGACTAGACGAA
  48CGTACTCGCATGCCCCCGGTCGAAGGATCAAGGTGATAGAACGGGTTTCCGGTGTGATCC
  49ACTGCGGAGAAGCGATCTGGAACAGAGTTTATCAGGGAGACGGGATGCGATTCATTACGA
  50ATTCTCTCGCCTTTCTGTACAAACATACATCAGAGCGCGATTTGGAGCAGGAGGCTCCAC
  51ACCGCTTTCCTAAGGTTAATTGTCAAACCAGGCTATTAGACGAGAGCTTCGGTCTTCAAT
  52AGCGCCCACTATCACGTGCGTAAGCTCTTCGATTGAATCGGCCAGGGCATTTTTCCGGAG
  53TGGGCAGCTTTCCACTGTAGTTCGGGTAATGTCACGAAATTTCAAGTGGTCCGGTACTCC
  54GTCAAGGAGGAGGCGGTGACCCGAAGACCCGTCTTCGGCAACGGGCAGTCTAGGAGACTC
  55GGATCAATGGAGTGCGTCAGGTTCCTTCATGTCTGGTTGCCGTAAAGAGGGAGCCTCCCC
  56ATACGTTCGCGTTGTAGGAAAGCGAGGCTTGTGTACGAGACCTCTGCCACGCTTTTCCAC
  57ATATGCAACGAGTTTGCAAGCGTCCGAGACTAAATGCTGGGGACCAAGAAAGGTTTGTCG
  58ACGACGGGCAATGACTACGCCGTTGGGACTGGAAGCGCTACTTAAATACCCGAACGGTGA
  59TAGTAACTCATTAGTATGAAAGTAGAGCAACTATGATTTCAGAACTAACAACGTCCATGA
  60TTTTGCACCTGCGGCTCCTTCTAATGCTCTTCGGAATACAAACGGGCATATCTTCGCGCT
  61CAATGATGCAGCAATTGATGAGTTCAGTGTGTAGGGGCATCTAGTTCCTATTGGTTGCGA
  62AATAGCTCGTAAGCGCATTATGTCCGATTTAATTAGCTTTTTTCACTCAGCTAAACTCCG
  63ACGTATCCGACCAATAGGCGAGGATGGGTTATATTAGAGACTGCTCCCTTATCGTAACGA
  64ATTAGGCATTAAGGCCTGTGCTCTCCTCGGCTCCTTTATGTTGCGTTCGGATCCGGGGTC
  65ACACGTACATATGGCAGAGAGGTTTGCGAATACTCTGCCGACGGTTTCTCCCTCAGTCAT
  66CTTTGAGCCTTCACTAAGCTTTAGAACTCCGTCCGTCAAGAATACGAGCGCACGTCGAAA
  67CGTGTCGACGGCGCGATGGAATCCCAGAAGACATATAGTCACTTGCTGTCGAATCGTAGT
  68GGCTCCGCTGGTTCGGGCAGGGGTGTCCTTCGCGCGTTTGCCCCTATCCTTACCTTCACA
  69TGGAATGTTCCAGGCCGATATGACATACTCCGTAGTTAGGCTTTGACACAAAGACGTGTG
  70TCATCGGAGCTTAGTGGATTATAGACCTTAGTCGGGCATTCGTGAGAGGTGGTGATTCGT
  71GAGTTAGAACTGTGATAACGATATCCGCGAAACGAAGGAGTTAGGACGCGCCGCATGGAC
  72GACTGCTATTTGTTACACTCAAGGGGCAAGCGGTGCACCACAGAATCAAACACTGTCATC
  73GCTAACCATTAATTATGCTGCATGTCCACCCTGCAGGCGCATCAGCTAGTGATCGTTATA
  74CCATGACACTGGGTGACCATATTAAGTTGGATTAGCATGCGATCTCCATGATCTTCCGCT
  75CCGACAGCTAGGAGTTTAAGGAGTTCCCAGACTTCATTCTTTCTCATCATTTTCGGTTTT
  76CAAATCAGCCCACGAGGTTTGTGCAATTATGCTGGGAGACAGCCACTTATGGGATGATGA
  77GAGCTATTGTAGCCTGTTCTGTGATCGTAAAGCGTAGGTAGTTTAGCTCGTTCCTAGGAT
  78GACTGCTATGACCTCGGGCTCATGCGTAATTTTAGCCGCCACGGCTATGCGTGCCTAATA
  79TGTGTGTAAACAGAGTTGGCAAAGGGCGGCGGTGAGAATAAAAGATCACTCCAGTGACAG
  80GGACACAACTACTCAAACACCCTCTGTTTTGCCGTGTTGAGTGCAGCATCCATACGTAGG
  81TAACGTTGGCGAAACAGTAGAGGTGAGCAAAAAACGTAACCTCGTGGGCTAGCGCTGTCT
  82TCTTCAGAAGCCCGTCAGTGCTAGCCCACGTATGAAGGAGACTGTTTACGGGCGAGTCGA
  83ACCTTCACTATTGTCCGACTGTCTCCGCGACGGGGCTGTGGGGACTGTATGGTTGAAACT
  84ATCGCTACCTTACCATCGGCGCTCACCCCTAGGCATCAAGTAGCCTAGCGTTTTAAAGCG
  85CCATGAGTCTGATACATCTCAGATCCTGTAAACATAACTCACGTGTACCTGCCTATAACT
  86ACTGCGGCTCTATCTCATGCGCGAATTATATTCGCGATTTCGTATTCAGTCCAACATAAG
  87ATCCCTTCGGCTCATATAAGAGTAGACCACTACACGTAAGGCCTCCACCATCGGGAGTCG
  88AAGCCTAATAGCCACGCCTGCGAAAGAGCGACGGTTCTAATGGAGTGTAGGCAGCCAGTC
  89AAGGGCGAAGATAGTTCGGCAATAGACGGCTGCGCTTTTACATCGTAACTCCTACGCTAT
  90AAGCGTACGACTACAGACGCAAGTATCCGGCGGTTAGACAATTAATGAACCACTACGCTC
  91TATCTTCCTTCTGATGTCGAGTATGACAGACCACTTAAATTCGCCCTAGCACACAGCCTT
  92CACCCAACAAAACGCGTCTGGTTTATCGCACGCGAGGAATCATGTACGCAAATTTATAGA
  93CTGGGGAATATACGGATTGATTATGTTCACCCAATGGTTCAGCCCACATTATGCGCACGA
  94GACGAACGAAAAGCCTCGTCCAAACGCCTTGCTTTTAAGAAGATTCGCTGGAGGATACAT
  95CGAAGTAGAGGAAGTTTGAGAGGGATCAACTCATGGTGATAGTAATTTCACCGTTTGATT
  96CTACGGTCATAACAACTAAAACCGCACTACGCATTGCGAGGAGTATCTTCTTTACAATTA
  97AGGACCGGTGACTTCTGGTCTGAGTCGTAGAAAGACTTTGCAAATCACTTGGCGCATTAA
  98CAACGCGCAGTCGTGCAGGTCAGGGTTCGTCATGCCTAGTGCAACGCCATCCTTACGTGA
  99GAACGGGCGAAACAAGTCATACCTACAGAGGGGTTACCCTCCTGGTCCACAAGCTGGTAG
 100CGAACTAGAGCCTAACTCGTGTTAAGGTCGCTAGTGCTAGCGTCGTGGACCGACGATATC
 101GCATTTCAGCGATGCGCTAGACAAGTCGTATGCTCAGGCATTATCCCTCCCCGCGCATTA
 102TGGCCTCTCGTAGATTCAGGCTAACGCCCACAGTCTGTGTCCATCTTTACCCCCCGTGTA
 103GCCAAGTTCCGTTGGAGCTGTCTAGCGGTCGGGTGTGGGTTAGGTCTCGGTCTGCGTTAT
 104CGCTGTGACATCCGTATGCCCATAGAGGAGCCCGATCTTTTGAAATATGCCTCATAAGGA
 105ATCCCGAGCTCAGCCGCCGTTTGATCATTGAACCCGTGCACGCTAGGCTAAGTGTGTTCT
 106GCTTTAGGGTTACATCGCGCCGAAATGAGATACGAAGGTCCGCGGAAAGGCTCCACAGCT
 107GATAGTACCTGGCTCTTCTCTCCAGCGTTTGGACGGCGTGGCCTAGTATGCGTGTGTCCT
 108ATCAATTCCGATACTATGAGAGAAATGAATTCGACGTAAATAATCTTACAGCGGCGGTGG
 109GCTACCTACTCATCTAATACTGGCAATGTGCGTAGCCCCTAGTTTTTTGTACCTGGTCAG
 110TCATGTATACGCAGATCATTTTACGGTCTTATCAGTTGGATCCTTCTACGTCCTGACCCA
 111ACTCGCACTTCTAGGTACTCTGGCCACGCGGGAGTGTATTTCGTTAGTGCCCTTGAATGC
 112GATGGTAGTTCGATCATTTCAATTACTACCCTCCCAACGTATCCGGCCCATCCGACTTCA
 113AGTCTACTCTGGGTTACAGGACTCTTGGGTTGGGACTCCACTGTTCAACGTGTGTGGGAA
 114CTTTGTCCAGCCCACACCCTTACGGAAAGACAAATGTATTGACAAGAGTCCGCGAAGAAC
 115ACCACAGACCATGCTGTAAGCCATTATGATTACACGATTCCTCTAACTAGCGTCCTCACC
 116TACAAGTAGGGTCTGCTTAACCGCGTATTCAGCCTCAGCGATCCGTGGGGGATACCTCAG
 117GAATCTACCCTCCAGTTACGGTGCTTGGAGAGGCCAACCGGCTTCGTCGATCACGTACGA
 118TGGGTTGAATGGACGGTCTGCGTCTCCTGTTGCCACAGCACTGGAAAACTGTCCAAGCTC
 119AGTGTTTTCATGTCATGATTTCGAGTACATGCCCTAAGTCGGTCAAAGAACACAAATCCT
 120ATAGATGACGCTAAAAACGCCACGACGTGTGTGTCGGTGACTTGAAGACCCGCGACATAG
 121GGCCCGTAGGATCTCCTAGACTGGGTTGGTAACGCTACTGTTGAGTGGTAGATCGCACTG
 122AAGGGACGCACATTACGGTGGGGGTCTTGTCTTTCCTGTAGAACTCGGTGAGAGATTTGG
 123GTCCGGGGAGGGGTTGACATTACTGCGGCAATTCCGTTATCGCACAGCCGCCGGAAATGC
 124TGATTCCGCCCGTGGCGAGAGTCAGCCGATTAGTTCCAAGCCAAATCGTAGGTTGCCTTC
 125TGCCGAGTAGCCACGAATGATCGTAAACAATTGAAACGTCCATCGCCGATGAAATCCTGC
 126TCAGGAGTGGATGTAAACTCCCCCGAGTTCATGACAATTGCAGATGAAATCCCGGTGCGC
 127GGAAGCCGCAAGAGGACTACGCGTTAGCCAGTGTAAACGCCTAGCGGGCGTATCTGGGTT
 128GCTCATCCAAGCTGTACCTGTGGGAGAGATCGCATCTCGTCCCATAAAGTTCGCAGTAAT
 129ACGCGCGCGCCTGGTCGAGATCGCGGTGGTCGCTTTCGATTCTCTGGGGAGGCATAGTGC
 130GTTTTTGACTTAAGCACTGTAACCCCCTATAGTAGGTAGATCAAACACAGAAGGGTTTTT
 131TTCGTTAGAGGTTGTTTTAACCAATGTGGGCCGGTCGTAGCGCACCAAAAAGCCGATCGC
 132ATGGGCTAATGCGTGTAGTCGATACCAAGTGGGAAAGAAGTGACGGAGAATGAGGCTTCG
 133GTAAACCGCCAAAAGGGGAGGACGGTTGGCAAAACACGGGTTTTTCCGTGAGGCAACAGT
 134CGACTCGATATGTGGTTTCGCCATTCAACGTGCTTAACATGTGCCAAATCTCTTAGAAGC
 135TCTACTACAACGATACTAGGGCTCAATCACGTGGTTCTCCAGAACACAATGGAGTCGGGG
 136TAGGGCCTCGCCACCCCGCCGAAGGTTAGCGCGATAGCATTCAAGCCTTTACTAACATCG
 137CTTTATTGATCTACTGGCCCAGTTGTAGGCATAAGATGGTCTGGAGAGTGATATGGGGCA
 138TCATCGAAAGTGGGAGAACTGCGGAACGGGGCTGACCACCTCTCTTTTAAGGCACCAGTG
 139AGTTATACAGTTTGAGGTCGATACTCTTTGCTAATCTTGTCCGAAGGGGTAGGATCGGAC
 140CCCCCAGCTCACGTCGCAATTACGCCTTTAAACCGTCAACCAGATTGCTTATTGCATATG
 141AATGCCCTCCATCGTCCCGCAGAAACATCAGGACACGCATGAGTGCAATGCTCCTCGACT
 142ATCAACCGGGCAGAACCACATGAATTCCTGATCGTCTCTGTCGCCGGGTTTGCTGAGTCG
 143GGCTACCTGACCCAGGGCCCAATGTCGCCATTGCGGGTCAATCCTTACACTCCGTAACCC
 144CCATGGCAGTAGGCTCATGCACGCACCAGTCAACTGTCGCAGTGTTTTGCATTGATTGTG
 145CAGCCCTAGCGGTCAGATCTCGGAAGTAAGGCGAGTCCTAGCGCTTTTGCGTTATTTGTT
 146ACCGCTCTCCTTGCCCAACTCTGAAGATATGCCTTGTCCAGATAGAGGCTCGGATGGTCG
 147GATTTTGGATGGAGGGGAATTGGGGCAAAGGGGGGCCAACTGTTACCTGGGCAATGCAGC
 148GAAAGGCTGCACATCACGTTAGAAGAGAAACGCCGTTTTCCTTCTACAGCTTTTTCTGCT
 149GTCTATTATGCACACAAGATTTGGTCAGTCGGATCCTACGGGGATTATCCGCAATTGTGC
 150CATCTCGGCTAAGGACCAATCTAGTTCCTTTATGCTTACCTGCCACGGCTCTGCCCAGTT
 151GGTCACAACGCAAGGATAGATTTCAATCTGACAAGACTAGCCGCTACGCATATGGATCCG
 152TCTTCCTGAAACCTGCTATAAGCTCTTAAAGTGCGTGCGTCGATCTACTTCTGGGTCGTC
 153GCAAGGAAAGTCAAAGTATGAACGTTCACAGACGATCATCGTGTTTCGTAATACCTAGAG
 154GGGTAGGCTGGCCCAAACGTCGTGTACTTCCCTTCAGTCCCAGGCTGCAAAGGTACACCT
 155TGAGGCGACACGATCCGTGTAGCGGCAGGCCCTCACTGCAGGGGGTTATCTTAACGCCAA
 156GCCGGCTCACCGTACCTAGGGCCGGTATAATTCCCTGACGCGCCGGGGGAAAGGGACGTC
 157GTATACTGGACTGGACATTGTTTCCCCGACAGAAGAGCGACTTTCAACTTAGTTAAACTA
 158GTTGTCGCGCCTACGGCTTAGTGCGGGTACTGAGCTTTCCAGACTTTAGGAAGTGACATC
 159CTACCCACACGCATGTGCAATAACTGGCGCGTAGAGTCTAGCCGATGGAGGTGTCGCTTA
 160ACTCAATTCGTTTAGATAGTGCTAAAGCTCCTTCATCTGGCGCCGTCGTTCCAAGAAAGT
 161GTTCATACTGTAACCTAGCAGGCGTTTTACTGAGTCCTGACGCGTGCTCGTTACCTAATA
 162CGGGACTCACGGTTAGCCGGTCCTGTTTTGTCAGTATGCATTGTGGCATTGGCACTTAGG
 163GGTGAGGTAATATCTGTAGGAAACAGATGTGCCCTCAGAAGAACCTTCACTAGACGGCGA
 164AACCCCGCTTGCTGGAGGCGTCGCCTATAGTCGCGTGCCCATGTCATTGCCGGTTTGTGT
 165CCATGGTATACTTTGAAGAGTCACCAATTGGCTGAGCTGATAAGTGTTATGTAGACGACG
 166GTTGGTATTGTGGTCGGACGTTGTGGCATGGCCCTTCTGAGGGACTGTTAGGTAGCGTGC
 167CATGGGGTGATAGCAACTTATCTGCCAAAGCCGATATCTCGGCAACACAACTCAGTCGTC
 168AAGGCGTATGCCCGGCTGGAGTTAACTCTGTTGCGTTCTTTAAAGGCGCTGTTCTTTGAG
 169ATGTCAGACGTAGACCGGTTGCTCGGACCAACAGACGTCTCCTTCAATTTTCAGGTAGAC
 170GATGGTTAGCTTGTTTTTGGTCTTTCGATTCGTAAGAAGGCGGTCCGAAATTGGTCACCT
 171ATCATGGTGAGTGAGTCAACATCGCAACCCCGAGGAAATGACCTCTGGTGAACCGTCGAG
 172ACAAAGAAGATTCAGTAACTTCTAGGTTAAGACGCCCCGTCCGTCAGCCTCACAATGATT
 173ACTCTATAGCATGGGTTACAAGACGAACATAAATGAACAGGACATATGAAGAGGCCGGGT
 174CGTGCCGCGGTATCAGCAACAGGTATAGCGCTACCCGTTCCGCATGGAGGGGAACATCTC
 175TAATCCCAAACCGGGGAAGGTACTAGAAATCTTCTCGACGAGTGACACGTTCTAAATAAT
 176TCGTGCAACCGCTCATTAACTAGTAGTTTTGGACCGGCGAGACCCCCAGCCCCTAGGTCC
 177GATGCCATGGTCGCGAGTAACGGGCGATGGAAGATTCTGTGGAATTACGCGTTAGAGGAA
 178AACGAACCTACCGCGCAGGTTAGGAATTTTTTTAGAATCATGCCATGAGCTCCGAGGTCC
 179GACCCTCCGTCGCTTCGGGATCGATGGGCTTTAAACTGGGCAAGTTACCGGATACTGTCT
 180TAGTCGAAAGGCGGACGATTGCACCCATACGTGAGTGGTTCGATAACGAAGGCGAGTACT
 181GTTATCTCAGACACACCCTGCCAGTAAGCCGTACTTGGCGACTCGAGACCGTTGCGTGCA
 182TTTAAGTGAACAGACAATAGCGCACGGAATAAGTAGCTCCAGCGGTGTGTCTCGTGAGGC
 183CGCACCGGATTACCGAACTGAAGCGCAGTGTCCACGCTCGTAGACCACGTAGTGTCTTAT
 184GTATACCCAGTTTGAATAGCAGTTAGCTGCGAAGTATAGATCTGTTGGAATAGGTGCAGT
 185CATGTGGGGAGCGGTCCGACGTCCGCTTCCGTGCCCTTTCAGTGAGTCATTTTAACCTAT
 186CGGTTTAGGTTGCGACCATCTGAGGATAATTCCCAAAAGGTGCCACGCCCTCTTTGATGA
 187GCCAGCAGCTAACCCCTATACGCCCCTCACCGGGGATTGAGGCTAGATGTTACCCTGAAG
 188CGATATTAGCAATCTTATGGTGGATTTCTATAGTTGGGGATTATATGATCTGTCGGCGTA
 189GGCACAGATCAGACCAAACTCACACAGGGCTATAAAAGATTCGTGTAGTCGACTAGTGCC
 190TACGACTAATATAGTGCTCCATCCGGTGAATAACGAGCCGCCGCTCAAACCAATCGCAAC
 191CACCCAGTCTGGAAATCATCCCCCAGTCGAGTAACCATACGGAGGACTAAACCCGCTCGG
 192CCCCCGGCCTGTCGCAGGTGTATACCGCTATACAGGTATATGACACCTAACTACTGGCTC
 193GGGTGAGCACGATGCATGTTGAGTCGCATACCGTCATTGAAAAAGCACTTCCTTACCCCC
 194CGGTGTACGGCTGCTAGTCCGGTCGTGTCTAGGTGAGGCCATAGATGTGTAAGTCATATA
 195TAGCTACCGTGGGGAGCGCTGGTACCAACTAATTGGTTAGGGAACCTGTAGCGCCAGCAT
 196CCAAAGTTCTCACGAGTTCGATAGACGTTTGAAGAAATTGGCGATGGGGTAGGAATGTGC
 197GACGTCGTCCCTGTTCGGTACAGAAGTGCCTTCACAGTATCCGTCGCTAATCACCCTATC
 198CTATTGTCCTAGCTGGCTCCTAGACACAAACGTGCTAAACACACAGTCCAGAAAACACCC
 199GTTCCAACACGAGGCGAATCACGACGCGATTGGGTTGAAGCGTTCACCCATCCCGGTTAT
 200GTCACCTTCTGGGCCTCGAGGTATAGCACGTACCATGAGTTACCCGATACCGACCCTGCC
 201AACGCCCTCTGCATGCCTACAGTATACTTGATTCCAGGAAGGCGGTTTGACGGATCCAAA
 202TATGCCGATGACCCTTATGTTTCCAAGCCTCATAGCCACCTCGAGGTGCCCACTCCTTGA
 203GTAGTGTCTAGGCAGTGCCTGTTTGAACAGGGCGACCTGATAGAAATTCCGTAGTGGTTG
 204GCCTACACCGCAGTCTTAGACATCGGTCGTTAAATAGACTGGTCCAAACGAGGAACGTGA
 205GCATGATAACTGTGTCTTCACGGAGGCAGTCAACTGCTGCACATATATTGTAACAGACGG
 206ATGCCGTGCGACTAATTCGGTCTTTTCTCTCCTTGACGGGAGTTGATGCCAATTTGTACA
 207TGCGCAGTGCCGTCCGCAAGGAGCACTTCATAGATTACGGGAAGCGAGGAAAAGCATATA
 208AGAGTTGTCAGTAGCCACTTCTTGCCGACGAGACATAGTCTCCTTGCAAATCAGTCTGGC
 209AGTATTAAGTCCAGATCCTCGGGGCGTAACCAAAATAATGTCTTTTTACGCTCACGGAGG
 210GAGGAGCATCGGGCGCCCGGTTCATGGCGCTACCGCAAGTCACTGTATAGCAGGACATTG
 211AGTCACGACATGCACTAGGAATAGCCACATTACGCCATCCAAACCCACTGCACGGGTGTT
 212CGTTCAACTGGTGGATAAATGGTTAGCTAAGGTCCACCCATTAGGACGCGCTACTATATT
 213CCCAGGATACTTATCGATACCGACTTCGAACCCTCTCCGCGCCGCGCCCCGGTGTGGAAG
 214AGTCCAAGCGATACCCTGGCAATTGTGATGGAACCCCGAGAACACTCACTCCTCCGATGT
 215CCTGGCTATTGTTAAATCCACGGATTGTGCTTGGCATCAGATGATGAGTCGAAACTTTTC
 216AGCGAGTATTGAGAACGATGGGGGGTCGTATTGAGTTCTGACGTGGAATAGCGCTAAAGT
 217CGTTGCGCGCAGTGCCCGCAGACACAACATCCCACTCTCTCCCATTCACGATGCTTCTCG
 218GGTTGATTAAGCCTCAGGCTACGTTCGACTGTCGTTGGGGGATTAATGGAGTGAGCGACT
 219AAGCGCCATTTCAGAATAGCAAAGCGTTTCGTCAATGCTCCGTCCTCATTCAAGGCAGAT
 220TGGAGTTAAGGCCCGGATGATTATCGAGAACTGATATGCTCTCGATAATGAGCACTTCCT
 221CGTTGGTCCACGTGATCAAAGAGTCTGAATTCGGAACAGGATAACATGATTGACCCCACC
 222TATCTTGATAGATGAAGTGGTCATTCAACCCCCAGAAAATAGTTATTGTGAGTACGGCGT
 223GAATATAATAAATTTTTTGGCGAATCTCGCAACCTGATGTAGTTGTGCGATTTTTGAGTG
 224ATGCACTACGACATAGGGTATGTGCTACCTTCGCTTTGTAATCCTCTCTTGGCCATAAAG
 225TATGCGCACAACACGTGGAGCGAGACCACGGCGGTTAAACAATAGCTATAGAGTTGAATC
 226GCGATCAACACGAAGGGGTCGCGAACTACGGATAATGATTAACCCATTGGAAAGAATTCC
 227CTCCTCACGTCGTGTAGTTACAACGCGGATTGGATCCTTTGAGCGCGCACCGCGTATCGT
 228ACCGCAAGTTGCTATCCCGGGAAAGTACCGACTGAAGAGGTATGAGTGTGAGGAGATGCA
 229ACGTTGTGGCACGTTGGGACAATGACGATTATCGGAACGGTGTCGGTACACCACACGGCG
 230GCCTAATACGTAAGCGCCGGCATCCTGTGTCACTTCTGCAAACCTGTATGGAGCGTCAGT
 231AATCTGGGATGCATGTGCTCTCGCGAATATGATCCGTTAATGCTGTGAACCAGTCATGAA
 232CGAAAGGTCGTAAATGTCGAGAAATCCTTCTATTATCGTTAGTCTTTGAGGTGGTCAAAT
 233CTACTAAATTTTGTACGATGGGCAACCACGATCAAAAACTAATGTTTCTGACACCCGTCA
 234CCTGCTTGTACTAACAAACTTCCTTGACCGCGTACCTATTAAGACAACAGATTCTGATAC
 235CCACGCGCCCACCTCGTGTTAATTCGGCCGTTTTACAGTCTTGAGTTCCGCCGACAGTCT
 236CAGATGGTACATAGATGTATCCCACGATCCTGGCGCAACACCAGAACGTCCATGAAAAAC
 237GTTAAGCAGGCAACGACTGAATATGCAGCAATTTTTCCAATCATGGTTCCTCCTCTACCG
 238CCCACCTGGTGCAGCGAACCGATTAAGACTGGCAGGCCATCTACCCAGGCTAGGTGGCGT
 239ACCCCTTGCACGTCTATTGCCGCTAACTCTGCAATCTGTAGAGCGGGCCAGGGTCTTGGA
 240GACGAAAATTACATTGCCTGCCCAAGTTCCTTCACGCCGACGCCCATGCGCTTGTTAGGC
 241TCAACGGGTAGATACAAATGGACCGAAGGGACTACCGATGAGGTGAAGATATTCACCCTT
 242TTATAGAGGTAGCTGTTGGTCGGAATCCAACTACGATGGCGTATGGTCACACTTCTGGCG
 243GGCGTAGTGCAAAAAGGTTGATTTGATAGAGCGATCAGAGTCTTCTCAGAGGTGCGGAGC
 244ACGGCCACTATGCGCTCGTTGCCGTTAGTGTATCGAGGCGTCAATGTCAGATAGCTCCCA
 245TAATCTTACCGAGGCCAAGCTTATCCGGGAGCATAGGAGTCAATGCATCTAAGATTCGCT
 246GTAGGCAACGAGGACCCCAGAATGAGCCAGAGGACACCCGACAGCCTGTTATTTGTGTAG
 247GACACGAGTCCTGCGTTCCGCGCACTATTAGCCTCGCCAATCACTGCGTGAAACCGCCCA
 248CTCGGGATTCAGGAACGCTCTTGACTGGATGCTTACCACACCTACTCTACATAGTCCCTC
 249CCTAATCCTGGCTCCAAGTATATAGTCAACCCGACTTTATCGACTCCTTCTTCTTTGATG
 250CCAACCTCATAGGATCCACACATGTGGCTCAAGAAACTCGTCACCTGGTTGCAGTTACCT
 251TCACCACGAGATTAAATGGTGCAGTTCTCGTATTCATTTTCTGCAGCTCAGTCGCAGGTT
 252CGTACACCTAACTTGTCTTGTCCAAGAGCACGGAGAATCATCCTATGGGCAGTGGTATCC
 253TGTCGGCGCGGCATAAGGGCATTTCCGCATTTCGCTAGCGCATCTTCGCATCTGAATGCA
 254CATGTACTTTCATACGTGACGTGCCTCCCTCTTACGCTGAGTACACTTTAAGTTTCGCGT
 255ATGTTAGATAACTAGTCCTCCTTCGGGATAATTGTGGCTCCTGAAAACGTGTGCACAGCT
 256GCTCAGAGTTAAGGAGTAACTGAGACTATATGGGTGATATGATCTATGATTAGTGGACGA
 257CCGTACCACGATGTACTATATGACGGTGTCGATAATGCTTTTGGTTTGTTGGCGATATGT
 258CAAACATTCGGCGATCTGTGCGCTACGCAAACCACGAACGTTTCTGGTACCGTGCATTCA
 259ACCCGTTGTAAGTTTGCCCGTTAGCCGCATCACGCTCACCAGTTCTGTATCTGCGAGACG
 260AGTCAAAGCCTCTGCCCTAGGCCCGTCAAGGAACCAGCGTGCAGACTCATTTACAGACGA
 261TAATGCTAGGTCTTTTCGCCCAACCATGCCGACTTTATTTCGAAGTATCCAGCCTTCGCT
 262TTTAGTATGTGTGGTACTTGATAGATCGCGCACAAATATCACAGTAGATCGAAGGCCTTG
 263CAGGAGGATCCTGGCCGTCCATCACTCGGAATAGGCCACAGGTAAAGGTTATTCTACCTT
 264CTTGGCTTCATTGGATGGCCCCAATTCAAATGTGACTTACTTACCAATGGAATAAGACGA
 265CGGCAGGACTCAGCGAGGTAAAAAACGAGCCATTCTGTTTGAACGGCAAAACACCCGTCA
 266AGATGCTACGTTTTACCCCGGCTGGATATCCATCTCTGCACCTAAACGCGATTTGGTCGG
 267GTGGCGTAACACGTCGTGACAAAATGGGAACGATACCACGCCTTACCATGCAGCAGAGAA
 268GCGGCTTGTAAACATGCAGAGTACAATAGTACCTTGGTACTCCCCATGACGTATAATTCG
 269GCTTAGCGCGTCTAGAACGCGAAGTAGTTTCCCACCGGAAATCTATTAACCGGCACCGAA
 270GCGTCTAACAAGACCAACAAGGGATGGCAGCGATCCGGCAGCGGGTGGATGTCATAGCCT
 271ATCAGTCCCTCTATGTGACTTAGAACCTTGGTCTTAGACTTGTACCTTCAGCAACCGGAC
 272CGAGCTGATTTTCGTGTGGCGAGTCTATGAATGACTTATGTTCCCATCGCGCGAATTAGC
 273AGAGGGCCGCTCACGCCGGATACCACAACGCCAGTGAATGCTTCAGTCACCTGGCGTCGA
 274AACAGATGCGAGCTACCTTCAACGTGCGTTTTTAACCTTGCTATTAAATTGAATGTCTCA
 275TAAGCAAGTTAATATGCAGATAATTTGAGACCACACCATATTAGAAACATCTTGTTCCTT
 276CACGCCTGCTGAGTTGTTTTGCGGTCCATATACAGGCGCGCTTTGGGCCCAAGTGCATCT
 277TCAACGTTAACCTACGGTTAAAATTGATCGTATTCACATGACTTCACATCAACATAGTTT
 278CGTACACTAACACAATCCTAGTATTTTCTTAACTCTAGGAGTCATCTAGGCCCCAACACA
 279TCAAACTATCCGAGGATCACTCGATTAATCAGGAGGGGTCTATAGCACGAGCGCCCACCT
 280GCCACTTTCGCCGACAGCCACTGTATAACCTTGAAAATTCCAGTCTTTAATGTCCACGAG
 281TACGACGAACGCGAATATGATCGTTATAGTGCTTTACCACTGTCTTATTGTGTGCGGAGA
 282AACTACTCGAGCGCGCCGAAAAGAGAGAACAACCACGTGCTCGGGCTTTATAAGAGGGGG
 283TGTCTTGGGCTGGCAAGTAGTTGTCGCTATGACCCCATTGAGAGTATGATATGGTAAATA
 284ACACGCGGCCCCTCATGTCGGCCATAATCATCCAGACCGGGTAGCACTTGCCTGCGTGCA
 285GACTATTGAGATCACGAGCTAGATCGCAAGAGGCCTACCCTCAAGCTGTAGTTGGAATAA
 286CAGTCAGCCTGACGATTTCGATCTGTTGGTTTTCTACCCGCAGGGTCGGGAGGGCACAGA
 287TCTGTGGAAATCACTGAAATGCCATTAATTATAACTGAAGATTAAGGCGTACACCTAGTA
 288CATCAACGACCAAAAATTCCGCGGTACTGATTAGAATCTTGAAGAATTTACCGTTCTAAC
 289CAACGCGCGCCCCCTCCGCCTGGCCGGCGGGTGTCCATGGATTCATGGCTTACCCTTTAG
 290GGCACGCCCAACTTGAGCGAACAGGGCGCCATTCACACGCCGTCGCCAGTATACCGTGAA
 291TAAGGATGCGTTAGAGACTGATCAAGGTATATTAGCACTCTTAACAGCCCACCCCCAACA
 292TCAGCGACTTGTGTTATCCCTCGATACTAGTTTTCACCCCCAATTTTGACTTGGTCGCAG
 293TACTTGTCACGCCGAACAGCCGCTAACGCCACCCACTTGTAAACGCCTCAAGGCCGGGAT
 294AAACCAGAAAAAAAGGCTCGTGACTGTCATCATCGAGACGCCGCCAATACCTTGCTAAAA
 295ACCTTTACTCTAGCGTGGGGTACTGGGGTGGTATGTGGAGTTGCAACGGTAGTGCCATTT
 296CGGCCCAATAGTTAAACCGTCTCACGGCCCCTTTACACCACTTCTTCACTAGGCGTAACC
 297GGACCCGGGTGTGCAGACGCCGTTAGTAGACAGGGTTACCATAGACACGTGTCGTCAGCG
 298GTTACCTACCCCACACGAGCTAACGTGGCACTTATACTAGACAAGACCATGAAGCGGTCT
 299TGTGGGGTCGCCTCGGCTTGTCGTTTCCGGCGAAAGGTCACTCCATTGTGAGTGCGCGAT
 300CCCCCGATCCTGACTCAGTTATCTCGGGCGCGTTTACTTGCTACAAGAGCATACGCAATC
 301GCTCAGCCGCTTATAATTAGAACCGTGGAGTGTGATACAGGTCGGGGGCTACTCGCACTA
 302TGTGATCCACTTACCGTAAATACGCAAGCTGAGCGGATTCATAAACGTCTTATATCATTC
 303GCCATTTTGGAGCAGCGCATATATATAAGTGACTCATATCGAAAAGCGTGGTCGTCCTGT
 304TATATAAGATATTATAGAGGGACAGACTATGTTGTTGTCTGCGGCCGACAGACTATACTA
 305CCTATGTGCCCTGTCAATACAGCCCCACTTCACAAAGAGTCTTTGATGATAACCCTTCAG
 306CGGGGGGCGCATATTTAGCAGCATTCGGGTATCGCTAAATCCGCACAAAGAGTACGCAAA
 307TATAGCTTCAGGCATCGAGGGGACTCAACAAACAATCAGGAAACCTGTTACCTCTGGTGA
 308TTAATCAACGGCTGGACATCCAGACCGTAATATAAGCAGGTATGGCGACCCGCTGGCACC
 309CCCACGTGGCACGTTAACACGCATCGCGTTTAACACTTTCCTTTGGTGAATGCTGGGTAC
 310GACGCCTACGCGCACTTACTACCGATAGTCTCCAAGGTGTGTCTAGTTGAGTCTCGTCAG
 311GATTATCGTTCCTGATATGTAAGCTTTGAAATAAGATATGTATGTACTTTGTTACTTACA
 312AGTAGCCCCAACATTTTCTTACGAGTTCAACAGACAGGGTGGAGCAGCCCACGGCAGAGG
 313CTGTATAGCGCTAGGCGAGTCGATCGATGGCTCTTCTTTACCACTGGCGCATTAGAGGTC
 314AAAGATTTGTTTATATCTATAAGTACATTTAAAAGAACTGAGGAGGTTCTTCTCCAGCTG
 315ATGATAATCTGGGAGAGGTACGCCAGCGTAAATGAGGCGAAAGGAAGGGGGAAACAGGTG
 316GTGCGGTATCAACGGCTCACTGCTGGACATTGGCTATTCTACTGACTTGTACGGCAACCC
 317AATGCTTCGAAGCTACAAATTCACTCGTGTAGAACCTAGCAGTCCATGATCTACCTTTTC
 318GTAGTCAGCGTCCTGGTCATCCGCTTCGGATCTTTTATCCGCGTACCTGGGTTACGAGAG
 319GATCTTAAGGCATATTCCGTTATGAACAGCTACGCCCGCAAGATGAGTCATAAGGAGTCA
 320CAAGGCTATAATTAGCAACCAACAGACATGAAGATACGACTAAGCTTCTATAAAAGACGA
 321TGACGTGAGGCCTCTAAGCATAATCAGCGACCTGTCCCCTTGAGATGAGAACAAACCGTT
 322TAAGGTTAACTATAGTTCACCAGCCTTGCGCAGCGCCGCCTACGAAGACGCGGATTTGCA
 323AGCTATACCCGACATGACGCTTTCTGCGCGTCCAACTAGCCACTAACACTCAGAGGTTAA
 324CTCGTGTTGCAAGCTGGATTTAACCGTACAAGTCCTTAGGGGGATCGCCCCAGCCTTCTA
 325CTGAATTAACGGTAGTCAAGGCGAGTTCAGCCCAGCTCCTTTCGTTCAAGGGTAGGACTA
 326TCGACACACTAAGCTGCAGCGCTGCCACGTGCAACCAGGCCGGATCGACACACAGTCGAT
 327CGAGGCTGACACTGCTTTTAACACCGATACGGTTAGATAACAGAGTTCTTGTAGACCCAC
 328GTTCGTTGTATAACATAAATTGGTCTAGACTGATTGGTACTTCTAGGCGTACCTAGGAAG
 329CAACTTTCGATCTACAGTCAGCCAACGGGTATTACGAATGAGAATCACACGTGTTTCCCT
 330AGGTGTCGACCATCAGGAAGCGCACATGGACGGAGCTTTTAAAACAGTCGGGATGGACAG
 331GGAAGGCCGCCGCCGTCCGGTACAATGACGGTAGTGCCATGCCTGAGTCCGACTACGGCT
 332CTGCGGATTAGCCTATTTGAAACCTCTGAACCAAGGGGCCGTGTGGGGCCGCCTTCCGTC
 333GAGGAAAGTCTCACCTATCCATTGTGTAAGCGGTCTTCCGTCATGCGGATACTTTGCGGC
 334ATTGGACCGTACAAAGCTCCGCGCACTCTCGTACGGGTAAGACGACCCAGGTTCATGAAG
 335CGCGTTACTACCAGAAACCATATGCACTACCCTTTGGAACACTCATCAATATTACAAGTA
 336TCCGACAGCAACGTGGGAGGTGCGGGGGACGTGACGCCCGGCTAAGGGGAACGCTCTCTT
 337GGGCGTTTAACGCAGCGATAATCTAAATCTGACACTTAGACTGGACAGCTTGTACTCCTG
 338ACGGGTCCAACCTATTCTGGTCAGCCCGGACTGTCATGCTGTAGTTCATTGGATAGACAT
 339GCGACTAACCTAATGTGTTCTGTTCTCCCGATTGTACTATATTCGCACAAGTGGTTCAAG
 340GCCGTAGCTTAAGTCCACGACAATGTGATTGGAAATAGAACAAATCCTGTAATATGTGGG
 341CAACAAACTCCACCACGCAAAAAAAAGTGAGTAGACTAGGCTGTATAGAAGCCTCCTTCC
 342TTATCAAAAGGGCCCCACTACGCGCGAACCCAACACCAGCTATACAGCCCGTTTCAGCAT
 343GCAGGAATAGCTGAAACGCGTTCTTTTCAAATCACAACTCTAAGCAGGGTAGTGCGCATC
 344ATAGAGGATCCTGGCTGTCCGCTCTATAAGGCGGTGACGAGATAGATATACCGATCAGGC
 345CAGTGCCTGTTATGCCGAGCCTGTACAAAGCCGTACACAGATTACACTATACTGATACTA
 346TCCGACTCGTTGGGGTGAGTTGAGACCAGCACGCTGGGTACTTTCCGACATCGTTTACTG
 347GAAACTGAGGATCTTGCCGGGCTACTTCATAGTAGATAACGCCTAAGCCAATGTATGTAG
 348GAACAGGATGCCTGCAGTCATCTCCTATTCGCCGTGCCGATTCTGGTACAACGAGTTTGG
 349AAACTTTAACATCCGTACTCGAGAACTTACGAGGCCCCCCGCATGTGGAGAGGGGGTCCT
 350TTTCCCGGGTTAAAAGTGCTACGGTAATGGGCCGGTTACCTCCTCCCAAGTATCTTGTGA
 351CACTGTGCTTGGAACCCGCCCCGAGCTAACAGGCCAATGTGACTAGAGCGTGTCGCGGGT
 352TGCCAGGACAATACGCATTCCGTAACCGTTCTGGAGAGGCGGCTATAAGTCTCATCCCAC
 353ACAGAAAATTGCCTACGACCTGACGAGACGCCACAACAAATGGCCGGATACGGCTCCGCG
 354AGAATAAAACCATTCCCTCATGTGTGTCAATCGTCCTGCATGAGCCTTAATAGGGGCCTC
 355CGGTGAACGCCCACTCGTATTATGGCATGTCTCTGTTGCCTGGTAGCGCCCACAGACGTT
 356CAGTAAGTGTCGGTCGCGAGAGTCGCCAACTCCGACGTCCGGTACAGTTTCTCAATGGTG
 357TTTACAGTTTACCTGGAACTTTGATGACATTTGTATTGTGCTTGTCATGGGCCAGAGGGT
 358CCGAAGTTAGCCGCTCGAAAGGGTGATAGCTTTGTTATTCCAGTCGAAGAAAGGTAGGCA
 359AAATGTGTGCAAGGTTAATGAAGTGCTCAACACCTTCCGTTGTCCTACTAATAGGGAGTA
 360GCATGTTTACTTAGACCCGACGACCGTCATCTACGGACGATCATTAACCGCGCCTGATTA
 361GATGCGACTGCGTCCTGCATACGCTCTTAGTGGTATCCAATCTTTAGCGGAGTGTGAGCA
 362ACTGATCCACCAGATCCCGTTTCGCACCGGGGTCATACACGGCAGAGTCAGATTGCTTGC
 363GATCCTCGACTGTATGACCCCACCTTGTTAACCAGGTTAACTGATCGTGAAAACCTCTGA
 364TTCATTTGTTGATCAGGTGCTGCTAGGCCCCAAGCTCACATAAGCCCTATATCCGCTAGA
 365CTCCCGATGGTCGAATCCGCATACAGTAGCAACCCGTGCCACTGCTCGATTAGTCTCATT
 366GTTTCCCATTGTACCCAGTACGAACCTGGGCACCTGGATCTCATGCAGTTGACGAGTTAC
 367CGCTTACCCAGACGATTACGATGCCTACGAGAGATCAAGCCAGGGGGCGTTGTGAACACT
 368AATTAGAATTGATAGGGATAATTTCTTGTCCTCCGCTTCGGTGCTCTCCTGCGCATAACT
 369CGGGTCTTAACGAATTCTCGGTAAAATAAATCGCTGGGCGTGATGAGTTTGCGGCGGAGT
 370ACAGTAACGCACAAAGATGTGAACGCTACGTCTAAGAAAGGAAGAAACTGAGGCTAGGCA
 371AACAACGAGGTAGTGTTGATCACTCAAAGCATCCTGTCGCACCGATCACCTGGAGTAGTG
 372TTCACAGAGCCGGGATCGTGTGCCGTCGCAAAAGACGTCAAGGGATCCCATAGAGATTGA
 373TTATCCATACAATGGTCAAGAATTACTAAGATCCTGGTCGCCGAAAACAAACATACATCA
 374CCTGGGAAGGGTTATTCTCCACGAAGCAGGATATGGGGTAACTAGGTTGAAGCTGCCACT
 375GCTGCCCTTATACGATATGGATACGTTTTATCGGATTCGGCCGGTGGTGAGGTGTCCGCA
 376TAGCGGACTGTATGGGAACGCTAAGAGTGTACTGGCAGGTACTTTCCAGTGTGTTATCAC
 377AATTGCAGAGCAAAATCCTTAGGTCGTATTCATATCGATGGAGGAGGGACCATATAGTAC
 378GGCGGCTACTGTTCGATAGTCTACTTCCGGTCAATGCGTGCCGCGACGATCCGCGGCATT
 379GGAGTTAAGTTTCCATCCCCATGTACCCCACTTCCGCCGTCCGGGTCTATACGTAGACAC
 380CCAAGCGTGCGTGCCCATAAGCCAACGAGGCATCAGGTCAAAAGCCTCAACGCTGCACCT
 381TGTTTTCCGGCGGCCTTAATAGGCCAGCCTACCTAATCCCTTAGACCTCGTGACTCCGGT
 382CTATGATCCCTAATGAAAACGTTGATTCCCAGAACTACACGTGGGAGGAGAGCTACGTTT
 383CTGCATAAACGGAAATATCCCCTTCAATTTTATCGTAGTCTCTACATGTATAGGTTGAGG
 384TCGGGACTTCAGGTGATCGGGCTATGTGGCAGTGACTGAGTAACATCTATGGACGATCGG
 385TGAGAATTGACCAGTACAACAGAATGAGAGATAACCCAATAGCCAACCACGATGCGCCCC
 386ACAAGCCTCGGGATTATACAGTACGCATTCATGATACCTGTGATCTTCAACGTCTCTTAG
 387AACTAATCCTAACATGAGTAGAGGGCTCCATCAAACAAGGTGGATGGTAGTTGCCAGACT
 388AACCACGCCATATCAGTTCACATTCAATACTCGAGGCATTAGTTAACTTGTAGGTTGTTT
 389CGATGGCTGCGGTGGTGTTCGGCACAATATGCCGATACGGGCCGTTCCGAGATTCATCTT
 390AGACAAACGGTATAGGTATGACGTATTAATTACACCACGGAGTTGCGGCCAGTGCTGCTG
 391ATTCTAGTGCGGTCCCGTTACTGAGTTAATGAGCCCGAAACGGATTCGTCGAAAAGTTGA
 392GCAAGGCAGGATAGTAGAGCCACGACATATTTAATGGCTATTTTGGTAGCCACGGCTGCT
 393CAGCAGAGTTGGGCCATCAGGCGATACGGGGATACTGCGCAATTGCTCGATACCACCGTA
 394ACATGCTATCGTCCGTGGCAGACTGCATTATACTTTCGAATGTCTGAGACGGGTCACGTA
 395GTATGATTGTTGCTTACTGCCCTTAATCGGGACGAAGTTCGTTTGGTTCGAGTTCTTACG
 396TTGACGAACACTTAGCGGATAAGTTTGGATATGTTACAATACGTCCATTAGTAAGTAACA
 397AGTGCGGGGGCGTACACCTACGTCGCAGCGGCACACAGTGCCCACGCGAAGCGCTCGTTT
 398CGCCTCGTTGGATTCACGGCGATCCGGTCCGTTTATATGACAAATCACTGGGGCTTTCGC
 399GAAGAACATTAAACATGAAGGTAAATTAACCGGCAGCCGCCTCCAGAGGCACAACATCAT
 400GCGAGGGAACCCAGGAAGGTTTATTCATGAGCGACATAATCCACAGCAATTAGTTGCTCT
 401ATAGAGGTGTGTAGAAACCAAAATAACCTGATCCCCTAACTGATAAAACCCCCCACCCGC
 402TTACAGGTGTACCAAGAAGCCTGTCTAGATTAGACGGTCAGCCACCGCGAGTAAGCTTTA
 403GTAATCGCATCTAGTCTCGCCACCATGAGGAACAAACGCCCGACATGTAACGAGTCCGCA
 404ACACCCCGTGTCAAGATCTACAGGGCTATAATCAAGCCACTTGTTATTCTTTTCCGGAGG
 405AGCCGGTATTCTGTGGTGCCCAAACCGTCACCGTGCCCCAAGTGCGAAACCCCCCGGAGT
 406ATATGGATTCATTTGACGACAGGCTAAGAGCACGTAATTAATTTTCTAAAGAGACCACTA
 407TCCCTACTAATAATATATTATCACGGTGTGTTTAAGACGACCCCACACAACACGCTAAGT
 408TCGGCGCCTTGCATGCATGATTAACGACGGCCTTAAGCCCATGAGCCGATTTTTTACTGA
 409CTCAGCAAGGGGCATACAGCACATCATGTCGCAACTCGTAACGCGCCTGACGCCCGCACC
 410GTGGTTCCCCCCGTTACAATACCGGGAAGCCACTTAGACACGCAGAATCAGCCTTACAAT
 411CCAGATTGTAGCTACCACACGGTTCGTGGTCAACGAACTAGCCCCGGGTGTCAGCCCATT
 412AATAGGCGTAGCCTGTCACCGAGGTTTAAGTATTACCCTACGGTCAGTCTATTGGGGCGG
 413AGGTCGAGATGCCAATCGGGCGCCATTGCGACAGACCATCTCGCGTATCGCTAGAAGTTT
 414CTACGAGTACATTGACCAATGCGGTGTCCGATCAATATGAAGATCAAGCACTCTGCCCGT
 415TTGATGAACGAGCACGCGAGGGCACTCTATGTGAAGGAGAGGGTTTCACGGAATACTCAT
 416AGTTGTCCTTCCCTCAGGAAAGAAGAGCCGACCTATGCACACTGAAGTGTTTCTTTTCAA
 417ACCCAGATTCAAGTGTTAGGTCCCAAATGCTGGATGGTCGAGGTCAGCAATACACCACAG
 418GTAATTTGTAATGGGAGACGAAGCATGACGTTCTACTTTGTTCGCAGTATCCTAGTTCTA
 419TGACGAGCTCTGAAACAGACCCGACATCCTCCCCGTCAAACTTCATGAGGCTTTACATGC
 420GTGACATGAATCTGGTCAATGCTGCTTCGCGCACCCCAAGATTACGTGGTGCCCTGAGTG
 421TCTTGACACCGCACCCTCTGACTCGGTGAGCTAAGGCTGGAATAGCCCGCTGGGACATTA
 422GATGCGAGCTAGTTGCAATGCGCTCCACAAGGACACTCTCATTTTCCTCAGGGTGTAGCA
 423GTTTATAAAACATAAGCCGTCACTTTTTGATATGTTGATGAATTATGGAACCAGATGTGA
 424TCAGAAGGACAAGTTGGCAGCCTCAAAGTGGTAGCAGTGGCGGTGGCATGTCTGGTGTCG
 425CTCCGGCAGTTTGCGATTATCTACGGAACGGTCTATGGAACTTTACTAAATGTTTCCTGT
 426CAGTAGGGAGGGCCCGGCGGCCAAATGCTAAAAGTACGGCAATGCCATGGGTTGTTGCAC
 427CCCGTCGATCGTCCCTGCGATATGTTCCAGGGTTAGAGTTTCTCGAACGGCCTCAGACTA
 428TCGGAGCCCAAACTCTACAGAGTTTTCTCATACGTCAAGCATGCGTAGCCACTAAGTCCA
 429CACGGATTAGAACGCTGCGTGGACGATGCAGGCTATTTGTCTTGCAGTGAGAGGGCGCTT
 430GCCTCCGACCAGATCCATCGTTGCGAGAGCAATCTATCAAGAGGATAAGCGCAATGCCTT
 431TTTGAGGTTGTGTGATCATACCCGCAAGGTCCGATTGCGGTGAGAACCCACGCTATTCCC
 432ATGTTCGGGAAGGAAGAGACGCAAAATACACGTACTCTCATCGGCGACAATTGTTGTGGC
 433GATGAACCTGCGTTAAGCCGCACTTAGTGAACATTATAGGGTACTCCCGGTTTCTGCCCA
 434CCCGAAGTAACGAGTTTAACGTACATAGACGGTTATTGTTTACTGAGCAGGGCTAGGAAT
 435CGCACCAATTTGTACGATTACGGTCGCTGCGATTAAAAAATTGTTACTTATCGCATACTG
 436GCGCCTCCTCCTAAGTATGTTCAGGACGCACTGTATGCAGGGCGGTCGGTCCAGTTGCCA
 437CGTTGAGACTGACTGTGACATGGAACTTGATATGTCGGCACAAGTGCGGGGGAAGCGCAA
 438CTAACACAGTATTACGGGACATTATCCCGCGTAGAGGCGAAGTTGAGAGGCGCATCCAGT
 439GATGTTACAGGCACAGGGTACATGCGTGGGGAGCTCATTAGCCGGGCAAACCAAACGTAA
 440CGCATACTTATCCCAATCATCCCCCCTTATAGCCGACTTAAGGCTGCGTGGATTCCAAAA
 441TAGACAAGATTAGCCCTTAGCGGACTCCAGCTGAAAAAGAACAGGGTCCTTGCCGGCATC
 442GCAACAACCTGCAGTTAGACGATTCGGGGCTAGAATACCCATGACCTGAATGATCCCTAT
 443CTTTTTTAAACATACACAGCAGTACCGGAGCCCACCTACAAGATGCTAGGCGACTCGCTG
 444TAAAACCTCGTCCAATCTTTCCGCGCGAGCGCCGCCTTCACACGACGGCCCGGTAAAGAG
 445ATTCCCTCAACCATACAGTCTAAGAAGAGTTGGGATTTATTGCTCCACTTTGATAATTAC
 446GTAAGATCTACGGGCTTGAGCTACGCCCAGTGCTGTTCCGCGATACGTTTCCGCGCGAGG
 447GCATAGTTAACCGCCGTTCGGGTCTGGGGAAAGCTGTGGTGTCACGGACTGACGCCATTG
 448TTGCACAAAGTGCATGGCGACCAGTCTTAGCTGTCGACGATGTAGGTCTCCAGCTCGGAG
 449CCCTAGCCTACGGATAGGCGTGGGTCTCAATCCCAGTCTTCACTCAATGCCGAAATCTCC
 450TAGCCGTCAGACGCCTGCTAGAGGAGGGGTTCTGGCACGATGGGTTCCAAGGCACCTTTC
 451GTGCCCGCGAGGGAAGTCTTGCCTGGACCAGTTACACTCAATGGTGAGTACCCTATCCAT
 452CGGATTAATCATCGCAAGTAGACTTGTCTTAAGGACGACCCGAGACTCTGCCGGCGAATT
 453TTTCCTGTTAACGATGGGTCAATTTACTAATTTGCAGTACTAGCCGATATACATATTCGT
 454CCTAAAAGTATTCGAGAACAACCACCTAGCATTTTTTACGAACCGGTGGATGGAGTGCTA
 455TTAGGTCCTGAAGCCCTCTGCGATTTGCAGCTCCCACGCAACATTGAGTTAAGCACAGGA
 456ATAGCCGGATGACTTACTGATTACAAGATAATTACAGTGGTCGAAGACCGCACCCCGTCC
 457TGATGGTACGGATCATTAAATCCAGGGAGTCCCGAAAAACGTGCAGATTATGCAGTTAAC
 458ACGCTTCTTGCCCTGCCGAAGTGTACGTCGACAGTTCATAGACTTTAACACTATGAACTG
 459TTTTCGTTTGTCGCCCACCGGGCGGAGGCCAAAAACGTACCATTCAACCCTTACCGCTAG
 460ACGACGGTCGCGGACTACCCTACTCGCGGCAGGTTTCCTTTACGATCAAGCTTGGACTTT
 461CTCTGATACGTCGATGTAGATTTGGGGTCCGGCTGTACTCTGGCTCTGGCGCAGTGACCC
 462TTAATGTTTTAGCTTAAGTGTCTTTGGTATCTTCTGTGCGCCATATTCCGTAATTTCCTC
 463CAAACTGAGTGTAGGCCGGGACGAACAGTTTATAAATGACCGCCATGCCATGGCGGGGAC
 464CACAACATTACAGGGGCATTCGCTTTCGGGTTGCAGGACGCGGTAAGGCCCGAGCTCGCT
 465ACTGGTAATGGAACACCGTGTAATGCTTAATACGTTCTAACGCGTCTCTGTGGAGACCTC
 466CGGTACGCAGGGCTAAATCTCCCTCTTGAGAGCGCCTTTTGCCTACTAACTCGAATATCA
 467GCGTTTAGTTGCATAACTACATTGATCATTACATAAGAGCAAGAAGCCGCGGCCCCCGCA
 468CCCGACGTCAACCTGCCTGTAAGCGTGTCTTTCACCCTAGTCAAAGCCCTCCATTGGCCT
 469CAGGATTCGATGCTGCCAGGTTATGTCAAGACGGTGGTTATTGAGCCACTGATGACCCGG
 470AGTGATCGGATCTCCGGGGTCAAATAGACAGCGGAGCCCTCAACCCTATCTACTCATTCC
 471TTGCCGTGTACCACGGGCGCGCGTCTAAGCCCAAGGGCAGGGTGTCAGGGTAACTCATCG
 472ATTCTCTCTTTCCGTCTATCGGCGACTAACTCAGGTACATAAAGGTTGTGTGACAAGACG
 473CATCGCAGGACTACCTCACAGAGGCTTTTAGAACCGTCCCCGAGACCCCGCTGAGATCTG
 474CCGCTTTGAATCTATTCAATGCGCCACACAGGGATCTTTTTGCGGACACCTTTCAAGCCT
 475GTGAACCTAATAGAGCAACCCACACCCTTGTCCCCCGGCTGATAACCACGGTGTTAAATT
 476GGAATCCGTGCCGAGGCTTTGCGAACAAGAAAGAAGGGACACTTCCCGAACGCTTCCTGT
 477TGTGGAAAGAGGCCCGGTAGTGCCCAGGTACTGCCCCCCTCTCGATAGGACCGGGAGCGC
 478CAAACCCGGGCTGGCGCCCTGGCAATAGATTGTAGACTGACTTTCCGTGTGACTCCTCTT
 479AGCTGTTAGCAAATTGACCTATTCTAGGGCCGATGGGCGCTGCTGACGGGCGGCACCGTT
 480AAGATAGGCCTATAACACAGACCGGCTATGTTGCTGCGATTTTGTTATCAGCCTTAAGAT
 481ATTGCGAGAACTTCGGAGGCGAGTTCTTTTGTTCGAAGGATAAGCGCCATTGTCCGTCCG
 482ATGTCATCGGCCGCATTCATATCTCTCAAGGACAAGATTTCCATGAGGCTCCGTATGCTG
 483TGGCGGTTGTGTAGTGTCAAAGGTCGGTAGCTATAGGACATTTTGGCCAGCAATTCGGAG
 484ACCAAGGGGAGCTGACACGATACTTAACGATGCCGGTCACCTGACGGCTAGTATGATTCG
 485TCACGTTCATGCGACTGTCCATAAGTACGGTCTAGCTCGTCAATACTGCATCTACCTGGC
 486AGGTGCACGGATGATGCGAGGTTCTCGGTATTGGGATGCCACCGCAATGACATCCTGTCC
 487TCAGTGGGAATACAGTAGGGGTGCATAGGGTGTTAGCGACGTCAATTACCTTACCCCCTT
 488TTCGGCAAAACGATGAGCAAGTTTCAAGGTCCGTACAACACGTCCCCATCACCTAGAAAG
 489ACTGATTCAACCTAGAGTACAAGCATTATTGTCCGCCCGCGAGCAACGTGTTGGCGCAGA
 490AAACGGGTTCACCGGCGAACGTAACCTGGCTGGTTACCTAGTGTCACTACAGAATGGGAA
 491TTGCGCCTGAACTGAAGCTTGTCTAACGGCGGCATTCCTTCTACCCCTGCGCAAAAACGT
 492GACTAATCCGCTCCAGGCCCGAGTAGTATGTCGACTCAAGGCCTTCCCTGGCGAAGGATC
 493GGTATATAAAGGCACACGGAAAGTCGCTGACATACGAAGAAAGGATGGCAGCCAAGTGCC
 494GGGCGTTGTCGAGAGGTAAACTGGTGAGACATAGAGCACACTATAGGTTGAACGGCAGTC
 495TTATCAGGATTGGTCGGTGCGGCTATAACACATCACGGTGCGATGGGACACTGGTGCTGG
 496TAGTCGATATGCGGCAATAGTCCCTATAACGTCAGTTGGTGACATGATCACACTCATAAT
 497CGTTGCGCAACGCGGAAGTCGCCTAGTTGTTTCGGTTACTCGCGATGACCCTGGGGACGG
 498ACCCTACGAGGCATTATCAATCACTGATAGCATGGGGTATCGACGACCCCCAGCGCAGAA
 499ACATTGCGCCCGACTGCATTCATTGCAGTAGTCGGCCTTGCACCCATTCGGGGCGATGGG
 500TAGATACAAAGCATGGACCCTTTCACGTAAGTCATAACAACGCGGTAGACTTAGCAATAA
 501TGTAGGAGTATCTATCATTAAGAAACAAAAATGTAAGATCCGGAGCCGAATAGTAGACTA
 502CTTATTACATGCCCCAGGGTGCTAAAGACCAGCAGATTCTGTAAACATTGGCACCACACG
 503CCCGCTGCGTACTCCTGCGGTATTGCATCCGGGTCAGTCCTCGGGTCCAATTAGTGTTGA
 504AATGTAGCTTGGCAATTGATGTTGGGCCCTGCTCTGCGTACGTGGTGGCGCTGAGAGTCT
 505GTACAATCGGGTACGTAACGGGCATTACGGCACCCGCATTTCTTGCGTCTCTGGACGAGA
 506GTCACGGGTCGGTCCCGAATTCGCAGGGTCGCATCCGTACCGTATACCAGAATGCTCACA
 507CACCTTTCGTGTCCTAGCCGTCGGTAGAATACTGGTCCATATTCAGCGTGCGTTCTTTTT
 508GAAGGTCTACGCACGCAATTGAGGATCTGATAATGGGTCTCAACCGGCGGCCGTTGGAGA
 509ACACATTTGCGTCGCGATATCCAAATGGTAGTCGAGCACACTTGCAACAAACCACCTATG
 510ACGGAGACGCCTACCCCGGCGTTATACTACCCGTTGGTAAACAAGCCATTCGGAGGCTCC
 511AGGTGCCAACAATAACGCCCCTTTTCCACGGCCAATGGTGTTTGATAGCCTGATCAATAC
 512CGTGTTCCCATCAGTAGTGTCCCCAGCCCGGTACCTCTAGTATTGTTAGCTTTACTTGAA
 513ATTCACACACATCTTTGGACATATACGTATTAGTCGAGAATATATGTGCTTCTTATCGGC
 514CCCTATGACGAAGAACGTTTTGAGGACTTTAAACACAGCCAGCGGCTACTAACAGTCTGA
 515GGAGAATAGCGGTTACCACGTCGAGAATTGTCCTTCATCGATCTTCAACCGATACCACAT
 516TTAAGTCGGTCGGGCCTCCCTTCGTGTTTTGTGGTAGCTAAATGGAACGCGCCATAGGAG
 517CGCTCATTCGTCGGAATAGCCAGGACTTTTCACGTGGGCACCCTTCAGCGTTGCCTGAGC
 518TTCCCATTTCTAGCTCGTAACTTACATTCCCAAGCCTCAGGAGACCCTCCTGCGGGTCCA
 519GGAGCGTATAGCAACCCGAGAACCGTTCCACTTGGAACATCGACGCGTTTGTTTACGTTT
 520AATTGCTGGTCACCCTGAGGTACGTGTGCGCCTAACCTAAGCATTCGCCCTACCGCTGTA
 521AAGTCGCGGCGAGGACAGTCTGGCTAGGGCTTCCGGTTCCATGTGGAGATTAGCCCGTAA
 522ATTCAGATCCCGATCGCCACCACTCGATCAACTTTTCTTTAACATGTATTCATTTCCAAT
 523AAAAATTCGGAGGCTCTGCTCTTCGTGTTGGTTTTTGTACCCTAGGCGATCGGATATCTG
 524TGGGCCCTAGAGTAGCGTTTGACACAAACATAGCTTGAGTGTCCTTTCGGACTCCACGAG
 525GTTAAGTTGCGCATGTGCCAACCTTTTACTTTTGTTAGGGTATATGTCTAGTGTGCGCCT
 526CAGAGCTGTGCTGATGGGTGTCCCCAGTCTTGACGGTGCGAGCGGAACTATGCATGACGG
 527ACAAGTTCCAACGCTAGACCAATCCGACTGTTTAACTTTATTCCAACGATTATGGAAGGT
 528ACTTCTAAGTACGCGTGTCGGCTGTCGATATTGGGTCGATGAAAGGTAGCGAGCGCGCCC
 529CCATTGTCCTATTCTCTTCCAAGGCATACCCTGGGCACGCATAAAACTTTCTTTCATAAC
 530CGATAGCAATGAGGAGGGGCCTAAGCACGCGTTGTTCATCTCCGAGAGAGACCACTGCCA
 531GTTCGGATGAAGCCACTAATTAAAACAGTCGCAGTGATCTTCCCTCGGCGGAGGCTACCT
 532GAAGGTCGTGCGAGTTTGCCATCTGGGGTTCCTCACCCAATCGTAGGTAAAATGTCACTA
 533CACAGCGTGGTGTCCTTATTATATCTCGCAGGCTGTCAGTGCCGGTCGTACTACGCCTTG
 534ACACCGAGTGCCTTTCGCTCCCACGGTTGGCGACTCATTTCAAATACCCCGGGGAACTAT
 535CCCCTAGTTCGAGGACGCTTGCGAAGCCCCAGGCACCGAAAGAGCATTCGTAACAATCCA
 536GCGCGGGTCTTCCTTGTGGACCACGCCCGGCCTTGCGAATTTACGTTCCCCGGGTATACC
 537GGGCGAGACGTACTCTGCATGGGCACCTGTAACTGTTATATGCACGATTATGGCTGGACA
 538TGCCCTAATACGGGTAATTATGGGTCAGCGGCATGCGGCGGGACATCCGACGTTAGAAAC
 539GTGGGATCTCTCTTGATTCCAGTTCTCCAGGGCCCTCAAACTGCTACGAGTAATTCGAGG
 540GACTCGTTGTTATCCGGGAGATGAGCCCCTTATATCGGACGTCCCGTTATCAGTACACGC
 541ACCTGCAATACCAGGCACAAACATAAAACGCCTTCCACGTGTCGGTTGCTTCATAAAAAC
 542GCTGAATACCATCCCTAACCTATTATTAATCGCAACAAGGCGCGTTCTTTCTTAGTTGTT
 543CCGGCGAGGGAAACGTAAGATTTGTCGTTCGCGATATTGCCGCCTAAAATATGTCGATCA
 544CTCTAATTACACTGTTGTTGGTCCGGTGGAGTTTGTAGGATTCTCAGTACCGAGTGAGAG
 545GTCGGACGGAGCTAAAAGTATATTGGCGCGCTCGCTGTGATAGGAGGCCCCACAATTCCA
 546TGTACCATAGATGGCTATACACGCGGACTCCTAATCCTACCAAAGCTTATAAAGCGACTA
 547TATTCGAGGAATCATTGGGGCTTGCAAGGAGCACACTAACAACCAACGTTCAGAGAATGG
 548TATTCTCATCGACTCCTGAGGCTACCACAGATGTTTTAAGCGGGCATAGTTAAGCCTCTA
 549ATTGGGGCGGATAGCCGCCCAACCGGGGACGAACGTAAAGGAGGTTTCACGCCAGAGAGG
 550GAGGCCCCCGAAGGGCCGTGTCTACCAACGGTGCGAGTCTCCTATGCCAATTGGTTTATA
 551GGACTGCCCGATAATTGAAGCTCTCAGAAGCTACATTCAATATTAGTGTTAATCTAGCCG
 552TGCTTCGGGGGGTGCTAAGTAGTTAGTGAAATGGTCTCTGAGATACGAGAAGTTCTGACG
 553CCCTTACTGACGGCCGGTTAATGTGTGAATGCAAAAACTGGAAACCTTCGACCGATGGAG
 554CGTCGTCTCACTAGTCTGCAACCCTCCCTCTATGGGGTCTAGGAACGAATAAAGGTTTCT
 555AATTTCCCCGACCGCCTTCTGGAGAGGTCTGCTGAGTGTAATCCCTTCGAACGATGGCGT
 556AAAAGCGGTGGTCACTTAACAAGTCGCTTTTAATAGAGATATTGTACGACTACGTGACGT
 557ACTAATTCGTAGGTACTCTTGTAACTGCAAACCACGTATCATAGTAAGGTGAGGATCTAG
 558TCTCCATACGGCCGTAGTTATCCCTCCAACGAGCCTGAATGGATATAGTTTGAATTCATG
 559GGGATTACTAACGAAGAAATTTCTTAGCCGTTACTTATCTTCACGATGCACATGATGGAT
 560ATGAAGAACCTCGTGATGGAGTCCCCAATATATGATAATCCGGACCACTTCCGGGATTAT
 561TTTTCTGCAGTCACCGGGTCCAGTTCTGATCTTAGAACGATCCTGTCCCAGGCCCAGCGG
 562AACTAAAACGAATGTCCCGGCCAGGCGAGCGTCTGCTGGAAGATAACCCTTGATCGCTGT
 563AAGCACTTTCAATATAAACCACAAACTCACCCGTGGACCAGCAGGTGGATAAAAACCTGC
 564CTGTTCCTGGTCATTGTCATAATCATGCTATAACTTGAGCGGGGCCAAGCTGCGTGGCTC
 565GGCGAACGATTGCCCTGCTAGTTACGGTACAGACAACCGCAGAGTCCGGAGCTCCCATAA
 566ACGAGGAATTCTCCCAGGGCTCGGGTTGGAGGCATTGTTCGCCTGGACCGGATAGGTGAC
 567GTTTTGGGGGTATAACTAGAGAAGAGATAAAGTACTGACAGACCCCGACCATCACGGCCT
 568GGCCGTAATCCCGGGTTATACTTTTCCCGGAAAGGGCGTAAACGGTCCTACCTAAGCCTA
 569TAAAGGGTCCTCCATTTAAGACTTGTCTAATAAAAGGGCTAAACATCTTCGTTCGCCTAC
 570AACAACTGAAGACGCCGGCCATCTATACTATTAATAGGTGTCGATTCCGGTGCACGTCTG
 571CGCGTCGCTCTGGCGGAATGGGAAGCGGGCAAAGGTTAAGGTCAATGATGTGATGTCACT
 572CCTCTCAGGACATGATCTACCTTCGCATCCTGTGAGAACGCGGAAGACCAGGTCACGACT
 573GAGCGGTGGAATGGAGCAAGAGCTACAGCCGTCAAAGAGAATATCACGACCAAGTATTGA
 574CAAGAAGGACTCATACTCATTCTTTGTGCCGGGGCGTTCTAAAATAGGGGCCTAAGGTAT
 575AGGGCTCAGGTTGATCACTGTATGATAGGACTTTCAGGACATAGTTTACGGAGGTGCTAA
 576AGTTCATATTCTGCGGACGCAAGGGCCAACAATTTCTGCGCGGATAGTCACCATATACTA
 577GTCGGATCTAAAGGACGGATGCCTACGAGCCAAGGGGCTCCTGTCGATCCTTGAGTCATT
 578CATCGGTCTTGCGAAATCTAGGTAGGTTGTGATGCGACTTACAGGCGCGGCAAAATGAGC
 579TCCGTGATTTGTCTGTAAAGGCGTCGGAGACCCGAAAATAAGTCCCACGATACCTGTCGG
 580GTTTCTAGATGACCCGTCTCCGCGTCATGTCAGAAAAAGATAACCCTAGTCTCTCCACAG
 581ACTTCTTCTCCGCCTGGTTAGATTTAATGAGGCCCTAAATCGCGTCCGAAGGAGCAGGTA
 582GCTAGATGCTCGCTCCAGTAGCGGTTGGCGGATCAGGTATGGCACGCCAACGCTCCGTTA
 583CCACTATCTTACCCCGAGTAGATATACGTAGCCGGAGCCCACGGTAATGATCAGCAGGGG
 584GATTGCAAGCCGTTAGTCCGCATCTACCGTTATGTCTTCCCGAAGAGCCTTGTGAGGCAA
 585CTAAGAGCTTTAGTAATGCCCCTCTTTGCTGGTTGCTAGGACTGATGAGTCTAAAAAAGC
 586TATGTCTGGGCGTAAATGACCCCGCCGCCAGCACTATTGCCTTATTATCAAGCCATTGAA
 587GTCTACTTACACCTCAGGTTGAGACGTACTCTGGGTTCGTTTAAGGACAAAGAGGCCCGG
 588CTCTCAGCCCAAACAGTCTTCACCGAGTCACGTTGCTAGACGCCTCAGGTCTTTAGTTCA
 589TTTTGCACCGCTAGAAAAGGAAGTTGCGCTGCGCAAGACAGGTGCTGCACTACCTAACGC
 590AAGGGGGAGTAACTTGTCTTGTTTAGTATCGTGACATTACGCGAACGTGGGCCCACAAGT
 591CATTAATTAACGCTGCACCGTTTACACCATACTTCAAATAAAGCTCTTGAGCTCCACGCC
 592GGTCCACCACCCCAGCCCATCGACACCCTTTCCGTGGAAGCCTTCGAGTACCTCGTGTAG
 593GTTTCGGTTGGATCTCTTTTACATGGGCCGTAGGTTCCTATCATGAAGTTCTACGTTAAA
 594TTACCAAGCTGCATATTACGTGGATATGCTGAGTCTTCGACACCTCAGCCCCTTCGTAAA
 595TTACGCACTGCATTCGAGCGTGTTCACAAGCTCCATTAAGTCGGATACCCTCTGAAGCCG
 596TGCATCTGCTAACGGCGTGTACAATAACGCTCTAGTCCCTCGTGAGTGCGGCTGCTTGAC
 597TAGTAAGGGTCTCACGGAATGGCGCGCAACCACTTGACAGACCGCGAAGATCTATATAAT
 598CCTTAGCATCGAGTGTCGTAGTCCTACGACGCGCATACTTGGTACCATTTTGGATGACAA
 599GGCCAGAATTTGCTGTAGGAGCGACCGCGTCCCGGCAGCACCGTAAGATAACCGCGAATG
 600TATAGCGTTTTCACAACGCAGCCTATCATAGGAGGGTACTAAAACACTGGTATCTTAATT
 601AGCAATGTAAGAAGAGGCCATAATCTGCTGATACTACGTCGGCGACATTCTGGACTTACT
 602GCGGTGGAACCGTGAATCTGGGCAGGAGGCCAGTGCCACCGGTCAACACAGTTTACGATA
 603CACTATCCAGTGCGTCGCCTCATATTGCTCGAGTTGGATGTGAACACTCTTGTGTGCCAA
 604GGAACTGTAGGTAGTCGACTTAGGGCCTGCTATTCAGTTGCCCGAATGCAGAAATGCACT
 605CATATAAGATACCGTCGTTTTCAACTGGTACAACAACAGCTGTAAGCTCCGCGGCACTGA
 606TAAACAAGAGAAATACCGATTGACCCCGAATAATACAATAGTAGGCTATTTGGTTTACCA
 607CAACAAGAACAGCCCTGATCAGTGCGCCTGGATGCTTTTTCTGGATCGTCTTTGCCCGGA
 608CACATGTGGGCTCTCGGGAGTACTGTATCGAGTCGGTCACTCACCCTTATCTTTGGGGCT
 609CCGAGAGGGGTCTAGACCACCCCAATGGGAGTCATAACGGTCAGCGTTATACACCCCATT
 610ACGCCCCGGTACCATGTGCTCGAGTCTACGTCACTCGATAAACCACTTTCGCTGTGAGTC
 611AGTAAGGGGCTGCATGCTCCAAGTGCCGTAATTTATCGCTTAGCCCTGAATAACTTGCCC
 612CCCAACTCTCCGCTTGAGCCTACTGCGAGAGTCTAGATTTAACGTCAATCCGGGGATAAC
 613AGCGCCACATACAGTTTTTGCACTTTTGTTAAGCGTGGCGCCTCTGCGGACTCGGACCGA
 614AGAGTGGCATAGATTAGAGACTTGCCGGGATGTTCGGTAGGAAGTAGCACCCAATGCCAT
 615GTGCTTTCGTTATAGTACAAGGGGGCAATCTCACGTACAGCAGAACTAGAAAGGGAATAT
 616AAAACGAGTAAAATCAAAAGACGGTATTTTGTTGACAATAATACGCCGGGAGTGCGTAGG
 617TAGTTGATGTTGGATCCCTTTAGGGTACTGAGTGCGACCGACATCAAGCTGATAGGTGTG
 618CTAACGGCTTTAAATCATACGGCGGTACCTTGTTGACAGCACCACAGCTGGCATTGGTTA
 619TGGGCCGTCAACGCGTCACAGTCGTCACATCTCACGCACGACAGGGGTGTTAGCGCGGTG
 620CAGGATACTGAATAGGGACATCAGGGTAAGGCTATTATCTCCTCCGTTGATGCTATCTTC
 621GGGCGCAGACGGGCTTTGGGGCAAAATCTTGCCAGTCTGGAAATCTGCCCTTGTTTTTAG
 622GTATTGGCCATGATCGGTTTAGGTCGGACGGTCGGCCAGGCCACACTGCGCCATACCGCG
 623CACGGTTTACGCGGGGAGACACGCCTGGCACGAGCGGAGGGATAGCTGTTTACGCGCTAG
 624TCCTAGGGGAAAATCGAACATAAAGCGTATGAATTACCGTCGACCCAGCCGACGCATTTT
 625GCTTATTCAGCGACTGGTATAGTGAAGTACGGTGCTCCCCTGTTTTCCGCATTTCTATGA
 626ACGTTATACACAGCTCACGGGGCGCGCCCACGCACAAAACACCGGATGCCCATGGCCTGG
 627TAAAAGAAGACTGGCAGCTAGAAGGGTTCCGCCGCCAGCTGGGAATCTAATTATCGCAGG
 628CATTGCATTGGCAAGCTTAATTTTGACTATCCTCAGGCCCTTGTTAAGTAGGTCCCCTAC
 629GGTGTTACACGTAATTCTCAAATTCACTTCAGTTAGTATTCCTCGGATCCTCCGCTTGGG
 630TGATGACCACACGTGACGTTATACCCAATGTTCTGTATAAAAGTAATCTTATGCATGCAG
 631TTCAGTTGGTTTACGACCCAAGTGTAGCCGTACACTTAGGACCAGTATACACTTTGTCAA
 632TTCAAGATGGCGTGGCCGAGAATTAGGTAGATCCACTACCGGACCGGGCGACTTATGGGG
 633AGCGTCTGCAATTAAAGGGTCTAAGCTATCGAAAGTCCGTGGGCGTCACTAGGAGCCCCC
 634TACTATGCAAAGGTTAGACTACGGCATTGCACCCACAGGATTTCGGGATTTTACCCGCAA
 635GACTCCACTGGGCCATTGTGCTCCATGGATGGTTCCACGATAGCCGACAATCTCGTACGA
 636AAGTATAAATATTTACCCGGCCTAGGTGTCGTGAGGTTGTGTTCGTGTAACCGCCATCTG
 637GCCAGTGCGCCAAAGGTACACTCTATTTAGCGAGTGCCTAGAAGAGAATGAACCTCAGAA
 638CCTCTGTATGAGTCATTCTGTTGACCCCACGCGCGCTCCGTGAGTCGGGCCCCTCGCGTC
 639TCGCGAGCCTAACATACCTTGAATTCCATCCGGTTCTCGACGCGTATACGATGATCGAGC
 640CTAATTCGCTTGGAACATCCCCATGTCAATCCGCCCCGAGGTAATACTAGACAACGAGGA
 641CTCTCTCGCCATAATTAAGATGGTGTCGCTGGGACTTGCATCATCTGGAAGTGAGCTTTA
 642GGGAGAACGCCGTCCACAGCACATCGACCTCTCATTATAGCGAATGAAGTCGACCCTCGA
 643CATGATGAGGGTATTACAATTGCTTTATATTCTTATGGTAACACATCCTCAGTGCTCGGC
 644CCTAATTGCGTCTTGAGTCGCGAAAGTCACGCTCCTAAGCGCTCACCGCTAGCCGCTGGT
 645TAAGGCGGCAATCTACAGTCCATGCGTAACTTCTGTAAGCAGACCAGCGCTTCGCGAAGA
 646CCATAGGAGACGGCTTGCCAGAAAGCGTGCTTGTGTCCTTCCCAGATACACAACATGGGA
 647TCAGCGCGTAGCCTCAAAACCCCCGCACAGCTACCCAGTTTCAACCACGCGTGAACCCGC
 648TTCTCGACCAAACCAGGCTAGGTAGACTCTCATGAAAACCACCGGGACTACCGCCACTTG
 649GAGCGGCTTGATAGCGAGTTGCAAGCATATCTATAGGGCCAGAAAGTAAGTGTTGCAGAC
 650CCACCAATGCATTATTGGTGCGAACGGGAGTGATTCTTAGCACAAAATTTCAGGATAGCC
 651CATCTGGTGGCTGGTGGTCCTTCCCGACAGGCGCGGAACGGGCAAATGAAATTCAATAGA
 652GACCGATGAAATGCTGCGACTAAGGATCCCCTCTATTTCTTCGCGGTAAACTAGGGGCAT
 653GCTTATTTTATGGCAATTAATGTAACGGGGGAACAAATATTTGCAGGACGACATCACTTT
 654GCAGGAGGTGGGCAAGGGGTAGACCCCGCAGTCGCTGTGCGATTATCGCTCGCGTTTACA
 655CTTGCAGTAAAGAACATTGCGTTACGTCGACTACGCCACCACTACCACAGGGCCGTTCAC
 656GCCGGTTATACTGCTTGTAGCGAGTTCGACAGTCACAACTATGGACGGAGACCATATCTA
 657GTGCATTATATTTCGTGACGGCTTGGACTTCGGATGTGGGTCCGGTGATTGGCCCTTCAT
 658AGCGGAACTGTGTAACAGCTGTCTATGAAGTCAATGAATTGGCGTGTTACGGAACCTTCT
 659GAAGAACAAAAGTCAGTACACTGCTAGGTTGCTGATGCAGCACACCGCCTCGTTAGTGCT
 660GTACCACACCGTCTTGCGTGCACAACTTTAGCTTTATAACCTAGGTATCAGTATTAAGAT
 661GGCCCAGCAGGCCGTACTTTTCGAACAAAAAGTCAACGCCATGGCCGTACGATAATCAAC
 662CAAACAAGGGTGCCATGGGGAAGTAGGCTGTAGTATTACCGATACATTGCGGCACCTAGG
 663GCGCAGATGGACGACAAATGCCCGGGTCGCTCTCGTTGTCATGTTTTTTGGAATGGCCTA
 664TGCGTTCGCATGAGCTCATCGCCGAAACCTCACGGACAGTAGCAAGACGTGAAATAATCC
 665TTGACACTATGCCTCCCCTTACTACGACGGTCCCCGCGCGGTTTGACTGAGGCGTTATAG
 666CTTGACCGTGACGTCATGACGGATATGCGTTAGTGTATCTGCCAAGATAACGTCCTAAAG
 667TAGCTCATACGGGTGGCTGCTTTGACGACGGAGCCCGGAGTTCGGTAAGGCGCCACGGCT
 668CATTCACTGCCGAGATGATATAGACTGTCTGGTCGAGTTAACGCTGACTTGGTAGCTAAC
 669ATTTACAGATTCACGAAGCTCTCAATCTAGAACATCCTAGTTTTACTATCTAAAAAAGAA
 670AAACATGGTGAGCTCGACGTGGTGGTTGCTGCTGGAGCGCTGTCCATCCCATTTGGGCAA
 671ATCTCATTCCAATTCAAACCGCCCATTTAATATATAATACAAGAATAAAGCGTGTACTTC
 672TGCGGCGTAGAATGATGCTGTAAGTTGAGCGCTTTGAGCAACCTACGGGCACGAACTGCG
 673ATTTTTCTCGACACCAGTGCCGGTGGACCCTCCTAAGGTTATAAACATCGAGAGCGCCAG
 674GTTTGTTACTTGGAGTCTGGCGAGACACGATCAGAGGATTTGCCGAAATGGAATGCATGT
 675TGATAAGGACGTTTCGTCGGAATATCCAAATAGTTGTCCAGTTGGAAGGGAGGTGGCAGC
 676ACCGACATGCTCATTTTTCCCCTTCGCGGTTGACAAGAAAGTCGGACGTGTAATACCCTT
 677CGCCTCGCCGGTCTGAATGTGCAGAATCCGAGACAAGGCAATTCTCCTCTGTCGCCGATA
 678GTGGCGGTAATATTGGATCCTAAAGCCCCACTATGCGAAGAATATCGTAACTACTGTCTA
 679CAACAGGGGTATTTTGACCCCGACAAATCTTGATAACGGACGTAGGGGTATCGAGGAGCC
 680GCTGATGGGAGTGCAATGTGGGTCGGTGACTGGTAGGGAAGGACTACGGACCTAGCGCAT
 681GTCAGGTCATCTGCACCCAAGCCCCTGAAGTTGATAGGCTGTGAAGCGTCGCGTGAGCAG
 682TTCCTCGGTTCCGTCTCTCAATGTGATACTGCGAGCCATAAAGGTTCAGGCTCTGTTCTC
 683AGGGGATTCTTCTCTTCCTTTAGCTAATCAACGGTAGTTTGGACAAACCAAAATCATGTC
 684GTGACGATCTTTCTACTCGACTCCGGCCAAGGTCGATGAACTTTGTAGATGCGTTAGACG
 685CACACTCAGCATATGGGTATGTAAGTAAACTCCACGTGGCTGCTCTGAGGTACTAATAAT
 686GTATTCGTAAATTCTACCATTTACTACGCCCTCCGAGATGCAGACCAGGCGCAGGTGTCT
 687CGGGTCGGCGAGGGGTTTGCAATAGCAACCAGAGATTGCCAGTGAGGACACCAACGGCGT
 688TGCTCCGATACAGCGGTAGAAACAAGGGACCTTGGATACTAGTGTCCGGTGGTTTAGCGG
 689GACGGTGGTTCAGAGCCTATTGGGGCGAGCGCCTTTGCCCCGCTGAAATATGTCCCGTCC
 690ATGCGCCAGGCTCTGTTTTGTTCGAGTTCAAGTGTCTACCTTCAGTTCGTTGGAAGGACA
 691ACGATCCGGTACGCCAAACTTACCCCATCCTGTCGGTTCCGCGAGTAGTCCTGGATAAGC
 692GGTCTCTGCATTCCATAAGAGTTAGTTGACTGTTTTAGCCTCCAGCATCGTTCGTTCGCC
 693ACTTAGGACAGACTATAAGCGCCATATCTCGTGGGGACGCCACGTGCTGACCCGCCGAGC
 694CAATGTCTAAACAGTAAATGAATGGATCCCGGCTGAGTTGTTTACGACGTATATCGAATC
 695CGTGCCGTCCCACAAGGAAAAATATAGTAGACAAACCGAGACTCCTTTATTATTATTGGA
 696ATCATCCAACTAGGCTCAGCAGCTCCGAACAAAGCTTGTTAGTGAAGGCATCGCATGTAG
 697AATAGATGGGCGCCCCCTTGTTTGAACGTCCTGATAAGGGAACCCGTGCGCACAGCAAAT
 698CCGTCCACTGTAGACTGAGTTTAATGGAGGTATGTATTCTGATACAATCGTACTAACGAA
 699AAATGTTCTAACCTCGACCCTACATCCCACCACCATATCTACACCGTCTAGTCTTAAACA
 700GGCTTCTAAATACACGGATCCCAGAAGCAACGGGGGTCGACCAGCGCTGACTGCCGCATG
 701ACAGTGATTGTAATTCCACAAGTGTCCCCATCCTTCGAACGTGGGCAACCACTTAGACTC
 702CGGTGGAAGACATTTCATCCACTTCTCCACTCTCACTACCATGTGCCTAGAAATTCGAGG
 703CCACTAGGCAACTGCCTGATACTAAGCTGACACCCAGTTTTTAGCCAATATACGAGAGCG
 704GGGTATAGTTCGGCCTTCTGCGGTATCACGGTACGAAGGTCTGTCTGAACGCTCATACTC
 705TGAATGATCTTGGCGTAATAGGCCTGCTTAATGATCGTCTGAGCCAACAACGGGACACAA
 706CATAAGCGCGGAGACTACAACCTTATAAAAACATCACTTTCCTACATCCACTCAGCTTGT
 707TGCAGGATCTGTACTCCGGTGAGAAACATTTTGATATTTATGTTTGCCCTATTGTAGCAG
 708ATCGAAGTTGTGATGTCTAGGAGGGCGCGGTTCACCAAATGAGGTACATGTCGCTCGCGC
 709TCACCCGCCTATTGCGGTGCCCTTGGACAGGTTGAATTCCGGACAGTTCCAGTTCCGGGG
 710AACAGGAGCGTTATAACTTGAAATTGCCATTAACAGTCAATTTTTTTAGTTGTTGGCTAC
 711GTGGAGCTTCTGCGCACCATATGTTACATCGCCAACGCCGGAATTGTATAATTGGGGTTC
 712CCGGCGTTTACGCGCAACATCAGAGATATGCATAGAGGTGGCATTCTTGAGTAAATATTT
 713CCAACGATATCTACGTTGGCGACGACCAACACGACTGCGTAAGCCAAAGTGATTTAAAAA
 714CACTAGGTTCGTCAAGACTTACTTAGTATAAAACACTGAGTGCAGGTGTGCTTCGTTGTG
 715GTTGATTTCTCCCGCTAAGTGTGCACAATTGCGCTGATCGGGTACATCCCCTCTCCACCT
 716CAATCAGGTTACGTCTTCAAGCATCCCCGGCTGCTACCGAAGGGCTCAAGCTTCGAGTGA
 717GTAAATAGAGGAAATCAAGAGTTGAGGGCAGTTGAACAGCTAGTCCCCCTCAGCGGTAAA
 718CGAACAAGAGATTGTATACATGACTGTGTTTACTAGTCCTTCTGTGGGGTGCGTGCCCAA
 719ATACGCACGCACGTACCGTTGCAAAGCGTCGTATCGACTGGATATTCCGAAACCAGTCAT
 720TGGTCTGCACTGCTGCGTGATGACTATTGTGCCAATAGAAAATCTCGCCAGATGCGTACC
 721TTGCAGAACAACATGTCCCGCTGACATAAACAATCAGCATCAAGAGCCTGTCCCCTCATG
 722CCGCATCGACCCCCTCACGTTCACTGAAGTGTAAACTCTTGCCAGACGCAGCCGGAAGCT
 723CTGGATTTAGTTTATGAAAGAGTGCCGCTTAATTGTGCGGACCTCACGCGACATTCAGTT
 724CTTAGGTATGTTTATCCATGGTTTGTAGCTCGTATCGGGGACCACACGCAATTAGCTTTA
 725GAGCACTTACCAGGATTCGACGTAGGCCCACTAACCCAACCCGTTGGGAAGCTGGCATTC
 726AAAAACCGCCTGGCCGAAAAATCTCTCCTAGTAGTCACTCGGACACTACTAGGCCTCGAA
 727GGTTCGACTTGGCGTCAGCCCCTATCTATAAGGTCTCCACATTCCGTCAATCGGCCTCCT
 728CCCTAGTCTTGTGCAATTCTAACGTGTGTACACGACATGTGCGCGTCGGGCGTGAGCTAA
 729TGCAACCCAAAGCTTTGACATTTGCTAGTATGGATTCAACAATCTTCCTGGGCCATAACT
 730CAGTACGCCGGGTGTGCAAATGTATTTTACTCCCAGGTTTCGCAACTCCTCACACAAATA
 731CGCTTCCCAACGGGGGTCTCACCCCGCCTCCATGTTAAAACCGTACGTGCATGGAAAGCT
 732TTAGCTCCAGGCTAATCGTAATTGCTGGCACATCTACAGCGAGGAGCGCAGCACTCAGTG
 733GCGCGCCTGTAATGGACAGGAATACGGCACTGGGTCTCACACGATAAAAGGCGCCTATAA
 734CATTGGACTCTAGCACCAGGGATAGATGATGCTCACACTTGGTATTCATTGCACCGGAAG
 735AGTTATCAAATGGTGCGACGTATTCCCTCCCCAACAAGAAGTTAGCCCCGTCGGAATGTC
 736TCGTCTTCCTGTTCTCGAGATCCCACCTTCATGTGTGGCACTTAATGGTAGGGTAGCCCA
 737GGTACGATACTCATGAGAGCACAGAAACCGGAACACTAATCACCTTCCTAGTCGGCGGTA
 738ACAAGACGCGCGGGACCCGACAAGTGACATCCACCGGTATCGCTACAGTGGAGGTCATTC
 739GAGGGTAAGCTTTAGTGGCCAACTGAATTTACAGTGCAGACCTACGTTACACCGATGAGG
 740AGTAATGGTAGACCAGTTGAAGCCACCTCTCCGACGTTAGTGGAAGTTGCTGTAAACCTT
 741AAAGAGCACCGCACCATATCCTACTACCCAACAAAAGCAAGTCGAGGTTGCACCCACGCG
 742GCTGGTTAATATGCCGAAGTGTTTACTCTCTGGGAAGTCGTCCCTTATTGGCCCACGTGG
 743ACATTATCAAATGCACAAATGGATTAAGAGAATATTATAATATCGAGGAGGTAGGATTGT
 744CGTCGTAGGATCCGTTGCCTATGAGAACTGACATGGGGCAGAGTGCGCGAAGTGTCGTGG
 745GGTGGCCATGCCGTCAATCGTCCTTAAGTTACCTATACATTCACACCACTGAATTATAGT
 746TGAACAACCAAACACCGTCTGTTGTTGGTACGGGGTGGAAGAATCGATCCGTCCCAAAGT
 747AACTGAGAGTACTCAATCTAGCTTTATTAGTCGAAAAGATCCACGACCCCCAGATCATCC
 748CAGTAGTCATAGAATGAATGCAGAACCCAGGCGAATGTAGTAATATGAACGCGACGGTTG
 749CCAACATTATGTTGGTGATGGGTAGCGAAGTCTTCCTAATTGGGCCCTCCCTTATCCGGC
 750ACTTAAATCCTATCTAGATACATACTGGCAACCTACTCAAGTCCCAGTACTGGTGTGACT
 751ACACAAGACTATGCCTCTTGAGAGCGCTTTGTAGCCTTCAGCACTCAAATGAGGTTCATA
 752TCTAAACTAGTGTTTGAATATCCCAACCAACACAACCCACTATGTTCATAAGCCACCCGG
 753CTGGAGACTAGGACAAACATCAGTGGATTTCAGTGGCGTATCGTTTTTATTGACCGTCCG
 754ATGTGACATCAGGTCCGCCGAAAACCGATAGTTAGCAACTCGCTCTCTAGCAGGCTTTTG
 755TCGGCAACACCCTGCACGTCACGGTTCGGACGCTAGTATAGACCTGGAACGAGAGCTTAC
 756TCTAAAGTAGTGGCACTGGATAAGATTTGTAGAAGAACAATTTCATTACCAACAGCTGAG
 757CAAGAGGATGCGGAAGTTGAAGACTTGGCGAGGAATTTTGCACTACGTAATATACGTTAA
 758CCGTCTGAGGTTGATTCCGCCGCAGGGCCTCGATCCGAGAGCAACTTGAGTCAAGGGATT
 759TACTTGCGGTGAAGCCCATCGGTGGCAACTTCTAATGCCCATCAGGCTTACCGAAACAAG
 760ATTTTAGGCTTGTAGCTAAGACTTCTTGAACATATTAGCGCAAAAGCTGGCTTCGCACTA
 761CAACCAACGCTTCTACGCCATGTTTCAATTAAACCCCCGTGGGTCGCTAGATATGACGAA
 762GAAGCGTGTCCGTACCGGAGAAGCAACCTCCCCCTTTGCTTTCTTGACCAACCGGCGTGC
 763ATGGACCATGTTCAGAGGGTGGCTATAGTGATCGCGAGGTCCGGCATTGCTCTAATTCCG
 764TCGCATTAGCTTGGCTGAGCCCGACGTCTCTTGCAGCTGTAGGGATCGATTCCCGGACTT
 765GTGCAGTCCGACAGTAGAGGAGTCTCTTTTTCGCGGAGACAATATGACTGTTAGAAATTT
 766GGAAATTACTCCTACGTCTGTGCACCACATATGATGTGGACTCCAGTTTTCTCGTGTTTT
 767GTGAAGGTAAAGACTAAGTTCAGTGCCCACATATTACGACGATGCGGCCCCGCTCTCTAC
 768ACAAAACCGCGACGTGACACTCAAACACAATACTCCTGGCTCGATCGTGGCCTCGAGGCT
 769GATAAACTGACCCTCAAATGGAAGCGGAATTGAGGATATCAATCTACTAAGTCGCGATGA
 770GCGGACGTCGACGTGGATCATTTACATCTCCGTAATCTGGCGTTGCCGATGTGGAAGTCG
 771ATATTAGATAGATCACGCTGACCTTCTGAAACTAAGATGATAAGCATTGGCGATCTAACC
 772CCGACGTGCCGCGGTTTTTCCATCTCCACGCGATTCCGTTTCACATCTGAAAATCAAGAG
 773CCACATGCCGACTAGTATGGTGGAGAAGGAATCCACATGGCTTATCATCGGACAATAACT
 774AGGCTTGTGCCTAATTGTTTGCTTCAGGATCCCTGAGCAAGCTGGTCAGATACGTTGCCT
 775CGAGCGTATTACAATGTCGCCCGTACGGTTCACCGGACGTATCCTATGCGTTTCGTTAGG
 776TTGACAGCGCAGACTTGTCTCAGAGAACAGTTCCTGCGTTTAGTCCGTATTCTCGCGGGG
 777ACGCGCAATTTGTCCCTTATGTCGCTTTCGCCTTGGCGGAGCTCTAGGATCGGGATCAGG
 778GATCTGTAACCGTAAGAGAACCTAATTCTGACGTTCCGGGATATTACTTCAAGTAGGAAG
 779GATATGCCCTTCGTACACCTGCTAAATGATAGTAGGGTTTTGACGATGCACTCAACATTA
 780GAGCAATGATGTCGATTTCATGAATACTTCACCGGCTCTTACGGAGCTGTTCCTGATTAG
 781AATCGCGCTGATTGCTCTGTGGATCGACGATGATAGAGATAATATATATGTCATCCGCGA
 782CGGCCGTCCTCCAACTACTATGCTCGATTTTACGCGACTCAATAAATCCGCAAGTGCACA
 783TCCATGGTTCCAGAAGAATGGAGTTGCAGGACTCCGATGTATTGTACTAACGCACAGGAA
 784CACAGGTGCCCCACATCCGCCATGACGGTGGATTCCCATGCATCCTAGAGTGGTAGATAT
 785CGAACCCGCAAGCATGTTCACAGATGGTCTTTCTTTACCCCGTGGGCCCGCGGTGGGCCT
 786AAGCTGATTGAAATTGCATGGCCAATGGAAGAAAGAGGTCAAGATCGCCGTTTATTAGGA
 787GACGATGTCGAGGGGCTCGATGTGGTCGCTTTTACATATAGTGAGCCCGAGCGCTAAATC
 788AGATGGTCGGCAGAAACCCTCTATCTACTTTTCTTTCGATCCTTCTTGCACGACGCAGGA
 789CCTGCGCGCCGGGCCACAGGAAAACGCGAAGCCCTGAACCCTTAAAACAGTAGACAGGGT
 790GAAACAGCATGGGCGTCGACAAGTATTGCCCACGAGGGAGGGAAAGTCAATCACAAATGC
 791AACCGCTAATGGGTGGCGTGGGTGTTGTGACGAGTGAGGAGCGAAAGCGCTAAGGTCATT
 792CACCGAAGTGGCTACTCTCTAAAATGAATTAATCCCGCACAGGTTTTAGATGATTTGTAC
 793GACCCGGTAGAACGTACGATGTGTTCGCAGGGGTTACCTCAACCGCCATCTGACCTGTAG
 794GGAACTATCAACAGGGTTGGAGAATCAGCAATTCTAAATCAAGAGAGCTCTTTAAGCAAG
 795ACCTGCAGCTACTGCCTTGGAGGTGGGTGGGGTTGCAGACCAGCGTGCTCATTGTCACAG
 796TGATGGAGAAAGAGTTGCACGAACGTGGATAACCTTTTGAAGGAACTGGATCAAGTTCCA
 797AGACTTCGGTGGCATCCGAAGTCTTTGTATTACTGAGTTAGCTTGGATAATTAAGTAAGA
 798TCCCATCGGATAGGTAATTAATTATCTTCGACTCGAATGGACGGTCGTACAAATAACATG
 799GTTCACCACAGCCATCCCAGGAGTATTCTGTCGTGGAATCACGCGCGTGTCCTAATTTAG
 800CATTTCGTCCCCGTTACCATACAACATATAGCACATTGGATTGGTCGAGGTTAATCAGGA
 801GACGGCCCAACTTTCGAAGTGGGGGCAGTGGGGTAACGCCGTACGGATGGGAAATGCTCA
 802CTGTTTAACCCTACATTAGCTAGTACGCATCCGAACTACAGGTGATCTATCTTTGTAAAA
 803TGCGGCTCGCCATAGTTATTTAGTTCGTCTTCCATTCGATTCTTCGGAGCACCGAATTTC
 804GGGTGCGATGTTTTGACAATGAATTCAGATTGGCCAGTAGCACATTAATATCCTCAACGA
 805AGGGTTTGGTATTCTGATGTACCCCGCCTTGTCAGCACTGATGAACGACCTCGAGTGTCC
 806GTCATTCTAAGATAATCTTGAGTGTCGCATTTGATCTACTATTTTAGATCTTTGCGATAA
 807GTTATGGGGTCGGACCATCTAAGATAGTTGTGCTGACAGATTGCAAGATAAAAGATGGGG
 808CGAGCGTGTCGGCCACCGCAGCATAAGGTCAATAGATCGGTCAAGACTTGTCAAAAATGT
 809ATTTTGTGTCAGGCGACTTAGTGGTGGTCATCTGATATCACGGTTCAAATCGGTACCGCT
 810TAAGGCCTATTCCCCAGCATACCTAGAGACCTCCGAGTTTGGATTCTGGACTCGGGAGAC
 811ACACGGCCGAAAGAAGGTAATCTCTCTAATCAACCGATTGTTGGAGAGGAGCCGGATCAT
 812ACTATCTTAGCTGTCGGCAACGCGAATACTTGCTGAACTAAATGTCACGACAGTGTTCTA
 813CGGGCCGCGCCGCCAAGAGAATATGTGCACGCTATCCCGAGAGTCTATTGTACATATCCT
 814GTCCAAGCGCCACAAGTACGGAGTACTTGCTAAAGAAAGGCTTGTTAGTCCCGTAGCAGT
 815CCACCGGCGAAATTGTGTCCAGGGGGCTGTGTAGCCATGTTGTGCCCTATACCGTTCAGT
 816TCTTTAAATTTGCGATTGGACTCGCAGGCAGACCACCACATAGCGGACAGCCCGATTGCA
 817GTAAAACCCGCAGTCAGCCGATACCAAAGGAACCAGCCTGTCTCAACGGTCGGCTTCAAT
 818GATTCACTCCCCGAGGCACTTGCCTAAAAATGCGGGGTCAATCGTTCATGTGAATTCATC
 819AGACAGATCCTGAAAATCATTACTACGCCCTCTTTACTTGAGACGCCCGCAGCGCGTATA
 820CGCCCACGTACAGCCAGGCCTGTCAATTAGTGCATGCACAAGAGTCGGTTTTCGACGTAT
 821CTCGAACCAGCAAGGTTACTTAGCGGGCCTAGGCCGCGTCACCATTTGTCCGCTTACGCG
 822CCCTGGGTACAAGCACATATACCGCCGGTTCAAGTGACCATCACGATGTTCAAGGCTAAG
 823TCGTTGCTTGTGTTACTTTGGAGGGAAGAAATCTGACTTACGTACTCAGAGAACGTCGCG
 824GCCTAATCTGGCACCCATCGTAGACATGTAACCGCGGATCTCGTGACGTGAGGGGTTCGG
 825CGTTAACGCAAAGGTAGATCTTACGGCCATTCCGAGTCAAGAAATTACATTTTTACCCGC
 826ACTGTTAGCAGTCGTAGTCGTACGTCTCTCGTGCCCCCAGGGCTCATTTACGCGAATTCG
 827AAGGCTAGCAATGCGTCCGCCTTGCATCTATAACGGCGAGGCCCGTAAATCCGAAAATCA
 828TAAAGGGTCGCTTGAGCCGCATGGTGGACTACAACGGTCTCGTCATTCACGAAATTTCTA
 829CTCCTGTGCACTGAAGATTAACCACATACTCGGGTGCGAGGCCAGCGGACGAGTAATAAC
 830TCTCATTCCTTACCATGTCTATTTTATGATTTCTACGAGTTCTAGATCTAATATGTTCCT
 831CCGGATTGTCCGGCTCCGGATGTTCGGCTTAAATGAGCGCGATCCGGGCAGAGCTTTCAT
 832ACTCAGCGTATGAGTCCCTGCCGTGCGGGTCGAATAGCGGCCACTTGAACGCGAAACGGT
 833CTGCACCGGTATAAAATGATTTACTAGCTAAAAGGAATGGTTGTTGTTCAGATTGGTATG
 834AATAGCAGATCTGTTCCGAGGTTCGCACCTACTTGGAGAACCATATCGCCAAATCGACAC
 835CATATCGTTTTCATACGCTATTATTCGTTGCAGAACCTAAGTCGTGTCTGCGGCGCTAAG
 836GCGACGCGCCTTAAGTGCCGAGAGAGTTGTCACTAGCCCTGAGTAAGTGTCGGCAGATCG
 837GGTTCTGGCTCTTAGTACGGATAGCAACTCTGTGCAGTTTGAGCACCCGTTGTACAACCA
 838TAGGTTTCTGACGGTTTAACTTAGTCGAGTACAGATCTAACAGTGCGGCGTAGTTCACCT
 839CCACTAACTACAATAGAGACCAGTTCAAGGTTTTATAAATACAACATCGTTTTCGTGTTA
 840CGAACATCCTCCCCGGCCTTAGTATCTCAGGCAGGCGCTTCACGCTAGATCAGAACGTTG
 841CCACTGTCTGCAGGGTCGCCGGCATGCCCATTCTAACTGCCTCTCAGGGTTAGAACGGGA
 842GCTACTAGTGTACCAGCGATGTAAAACGGTGCACCCCCAAATACAAACTACCACCACGGA
 843CCCCGGTTTTTTGACTACATCCACGCCATAAACCGTTCTGAGGGGTCTAGGCTTTGAAGA
 844AGACTGCGTAATGGGCCTACCGTCCGTGGCGTTGAGCCAACAAATGCACCGTTCACTTTC
 845ACATTCCAGCCACCAATCCAGTTCATGTGCAGGCCGGGGATTACAACTCGATCTCCTTAC
 846CCATGCCAAAATTCAACGTTATGGTTTGTATACTTTCCTCCTAAACAGTACTTTCGTCAG
 847CAGGTCCAGACTTGAATAGGATCAGTGCATTCTCTGTATCAACTGCTCCCTGACGTAAAA
 848TACGCACAAAGAATTTATACAATCCCACGACCAGAGGCGGCAGCTCATACCCCAGGGGTA
 849GACTGCCAGTGTAACTCCTGGATTACCGTAGCAAAGCCGACATCAAAGGTAATTAAACGT
 850GCAGCCCGGTGTAGAAGCGAAGCACCACGGAATCTAGATATCATTAAGCGGGCTGGAGAT
 851AATACGATGTAGCACAACGGACACAGTCATAAATACGCCAACGCCAGCCATCCTGGCGTC
 852CTGCGGTATACACTCGTTTCATGCGCTATGCACTGAGCACCCCGCTAAGTCGGAACCTCA
 853GGATGGTATACACTGGGGTAGATAATCCGGCACGATATTATAACTTTCCGGTTCATACCG
 854AGTCATACGTCGTCTTAGAGCGCATCTTTAGTTCATAAAGTCAGTTCTGGCTATTAAGTT
 855TCGGGGCGGGCCTCAGCCGTTTGAGCATTTGGCCATTGGGATTTATGCCAAATGAGTACT
 856ATCCAGAAAGGACCTGCCTGCAGCGTTGTACTTGAAACAATGACTATACGGTGCACATTT
 857TATGGTGTAGTAAACAAAACGTACAAGATCTGCGCTGTGGGGGGGTGGTTTGGATGACGA
 858GCGTATGGTCACTTTCGGTGCGATGTCTATTGACCACTGAATCTGAAAGTGTGGGACTTC
 859GGTTAATCAGCACGATGATCAGAGATGGGGTCATAATTCTCGAGAACTACAATAGTTCCG
 860TCTTATATGCTAATGATATTCTAAAGTTTCCGGAGGTGCGTAGTTAAGATGCTGCTACGA
 861GAGAAAGAGTGGAACTACGCCAGAGATGCCGTCCTGCCGAAAGAATAACGCGGAGAACGC
 862GCAAGTGTAATAACCACCAGTGACGGCGTTTCATCGGTGGTCGTTTTAAAGTGGAAACGT
 863CCACAGAGCGACTGAGGAGGAAGGGGGGAACCCGGCAGTCATGACTGTTCGTCACAGTGG
 864TATAGGCGAATCTGCACTAAAGTGGAGATATGAGGGATACTAGGGTGTGGTTAGCGGTTC
 865TGTAACGCATGTTACCTTACGTAGCCCTAAAAGTAGAGTACCTACACATCGCAGACACAA
 866CAATTACTTCTAGGCAGGAGAGTACTGCAGCCTGAGGGGCTCGCATCGCGACAAGCTAGA
 867GACCGGAAAGGTTAATTGGAAGGAGAGGAAGGATAGCATCGCACCCCATTATCGTAGCGG
 868GACGTCCCCAGTCTAGACGTAGGGCCGTTAGCATTTAAACATACGATGGCCGATACAGAT
 869GGAGCAGCAGGCCGGTTGCCTGTTCAAGGCCCTGTCGCGGACTCTGCGAGTTCTTGTTAC
 870AGGAAGCGTTATAACAGGGGAGCCCAAAAACAGAAGGCACCCCCCGCTAACAGGGTTGTT
 871GATCAATGCAAGCCAGTCCTCGTTACGTTCGGGGTGGGCTGCGTGGCCTGACATACCTAA
 872ATGGCCCTAGGGTAGCGTGGGGTGCTTGGATTTCCATGTTACCTGTAATGGCACTGCTAT
 873TTGGCAGAGCTTGAGAATCTCTAGCTAGGACCAATCACCGGACCAACATGTAGTGTTGCC
 874TGTTGGAGACCGCGTCGCGCTCGCCAAATCCGAACGTCCTGGCTACATGGACAGTCTTCG
 875CGACTCTGGACAGGTTTTGCGGTGCGTACAGGGGTCTTTCTACGTACGTTACCTTGCGGG
 876GACCGAGCTGGTGTCCTGATCAAGTACAGTGCATGGAAATGGGCGTGCCGAGGCCCCGCT
 877CAACTGATTATCGCGACCGGTGCGTGTAACACCATATTAGTTTCAGGCTAAGGCAGTAGT
 878CGAGTTGGGGACCTTGCCTACTTTATCTTAGAGTGCGCTCTTGCTCTAGGCTGATGTAGT
 879AATTTGAGTATGTCTGTGTCCACTAACTATGCAGATAACTAACAGCGCTCGACTTCTCCA
 880ATCACCACCCAGGGGATACGGTTTTGCGTGGACTATAAAGGCAATGAGGCAAATATGCGC
 881TACAAGTAGAGACGAAAAGTCGTGGTCAATCTATAACTATTTAACAAGCGCGCAATAGTA
 882CAACTACATGATCATGAAACGCATGAGGGCGAGGCCGTGGCGCGGAAGACATGAGAACGT
 883GCTATAGGTAAAGCGACTGGAGCGGTTTACGTGCTGCCACCACTCATGTGATACCTCAGC
 884GAAACAGGCGTTGCGTCGGAAGTAAATCCCGTCTTGTGCAAATTCGGGAAGATCATGAAT
 885CGGTCCCATGCATATAGCTGGCGCTTACTAAAGGTATCATTCTGGGTATGTCTCGGAGTT
 886GTACCTCCACAATTGCCCCATAGTGACGTCGCAGGGCTTGCTGAGACTGGTCTCACGGTC
 887TCGTTCCCAATCTCCCCGATCACACCCTTAAGGTGCATGAACGTGTCAGCTTCATTGAGC
 888ATAGGGAGCGGCAACGAGGGTGCCGAAAAGGACGTTATCCCATCAAAAGGGCATGTTGTT
 889CCAGTTGTGTCTTACAACAGTTTAGGTGAGCCACATAGTGCAGCATCAACGTACTTTGCA
 890CGCCACAATTTCTCGTATTAACTCTTAGCCGGTATTCAACTTGTAAGATGATTTAGGACA
 891CTGCTGACGAGCTAATATTTCTGATTTCTACCTAGTGGAATGCGGGGGCCCGCTGAGCCG
 892CTTCTCACTACGGGCAATGCATTCGGCCTTTCGGGCTGGGGTCACGAGCGTCCTTTCAAA
 893TTCCCTGACATTTATCGTTTCGAGCTGGAGTTGACTATACATCTTAACATACGAATAGGA
 894ACTGCAGCAGTACATAAACATCGCCGCCATCAACTCCCTCTGCAGCAGCCTAGCGTTTCT
 895GGTGTGTCTGGGAAGGCGCGTAGCCACATGTCAGTACTCACTTGTCAAACGTCCCGCGGC
 896ACGAAGACCCCGCAAAGCCGGTCAAGGGACTAGCCGTCTATCTACTATACCTCTTCCCTG
 897GGGCATTTCTAAATACGACTGGGTCCATGACCGTGGTCGAAGAACAGTATGGCACTCGGA
 898GTCAGTTCACCCTCCACTTGGGAAGGTAACAGACGGACAAGCCCTTCAGCGCTTCCCACC
 899CCTCGCTGTTTCCATATAAGCTTAGAGTATACCTGTACGTCCCGCAGCAGTGCGGTGAGG
 900AGTCCCAGGGCTTGCCGTGTGCCTTTTCACTAAGCCTCTCACCTTGAGGGCATGTGCGTC
 901AGCAAGCTACCAGGTCAATGGAGGGGAAAACAGTATCGGCTTCCCCGGCGATGTCCCGCC
 902GGGACGTTAGATCGATTTCACCTTACACTCTCACCCTCAATCTATATGTAGAGCTGGAAC
 903CTGCAATTCTTAATATTACGATGGCCCTCCCTATAATTTATTATGCTCCATCACACGCAA
 904GCTGCTGATCCGACCGGATTCGCCTCGGGGGAACGCAACTCGCGATAGTAGAGTCGATAG
 905GGGGTATTAATCTATTTACTATTGGCAGAAAGGGACGTCGAAATATGATTTTTGGCTGAA
 906TAGCTTTCGAAGAACATTATTTGGGATCTTCGAATTTGACGAAGACTACTTATCGCGCGC
 907CATCAGATCAATCAGCGCCTAATTGCAAGTCTTAATGAGTCGTGTCTCGCAGCTGTAGTG
 908CAGAAGTTTCGAACGTGCAAGATATCTTTTCCTTCAGCTCGCCGTTCCACGTCCTAGGTC
 909CCGCAACGCATTCAGATTGACATGCGTTAGAGTTTATAGAAGTCGCGGCAGGACACTTAT
 910GACCTACGAAGAGGGATAGAAAGACTCAGCAACCGCGTTGTGTCACGTCAACCGCGCGTA
 911TTAAAGCGGCCCTATTCCGGCGTGCACGGAGCTTCTCTGTATCTTAGACAGGTCCACGGT
 912GCACACACAGCACGTAGCATGGCCTGCAATTGATTACAGCGTGACCATTCGCTTGTGTTG
 913GTCTGATTACCTATTCATATAGAAGGTACGGACTTAAGTAAATATGGAGGTGCAGTGCTA
 914ACACCTCCCCCCCCGCTACCGAATAGGTACTATTCAGTCTAGCCTTGTTTACAACATTTT
 915CGTACAATTCTTTACTTTGGTGTTTATGATCCCACTACGAGCTCCAAAAGGTCGGAGCGG
 916ATTGTACTCTTTCTCGTCTTACGCTACGGTAGGAACACAGCACGTGAGATGACACACGGT
 917CTCTTGATTACAATGTCTGCGACTAGACAGACCGAAAAATCCACAGCGCTTATCTTTTCA
 918GCCTTGATGATTCTCGCGATCTTAAGTAGAAAGCTCTTCGTACCTGTAATTCGGCTCCTT
 919CTTTAGCAGGGCGTGCGCCGACATTCGAGCTAAGTACAATGGAAGTCAATGCAGATAGAG
 920TTGTGGTTGAGCGGCACTAGGTTGCTCCCCAACGTTAGGTGAACGCCAAGGGCCAGAGAC
 921TACAGATTGCGCCGGATTAACGGGTTCTCCAACCCTCAGTGAATGGTGGTGTCAGATTTA
 922ATCCAGACGTCATCAGATAGTGCAGTCGGAGGATTACAGATTAGAAAAAAGTGATCTATG
 923CCACCACGATGTGTCTTGTTGGGCGGGCGCTTGAATAGGACATATATTGGGCACGGTAAC
 924CTCTTCTTTCTCCGCCTAACGGGTTACGACACCCCAGAAGCTTGGATCATGGGCCCCTAG
 925AATCCAGTAGCCCAATATAATTTCAAGCTGTAGTCTTTTACACTCCGCCTGAGCCGCTTC
 926GTCAGGACGTCTTTGAACGCAACGCGAGGTTAGAAATAGCTTATGTTTACAACGGGAGCG
 927CAGACTAATGCTGCGAACTATAAAGGTGAACGATGCGGCGCGCTATTAATCTTCACATTA
 928TAGTAACGTGAACCTCAGCCCGAAAACATCAGCTGCTTAGCAGGGCTGACTCTAGTATTA
 929AAGGTATGTTCCATTGCTACAAGTAATAAGAAGTGCTGATCCACATTCGAGGACGACCAC
 930TCGGAATTGTGAAGCCGCGACCTCGCCTGCCCGTTGTTGGGAGTTTACAGCCTAGCCTCT
 931CGCTCAGATAGGAACTACAATGGTGAAAACTCTAAACGCAGTGTATGAATAACGTTTTTT
 932CTAATACATGCCCTACTTCTGGTTAGGTGGGTCGTATACGGGTACACATTACCTACGGCA
 933ATTCGGGCTTTCCGCGGTTCGTGTGGAACCACCTTTGCACATGCCATATGCCCAAAGAAT
 934GCCTAAGGCGTCCGGGGCGCAAGCAGCGGGGATTTTTCGATCCATTTCACGACAGCGTAC
 935CGCACCAAGGAGTCGTACAATTCATTGGGGTAAAACCACAGCGGGACGGCGCATCAGTGC
 936CCCCCCGTGTTAACGGCTATCTACGGCCCTGTATAGATCGGATTCCCGCGGGCGTTACAG
 937AGCCCCTGAAATATGCCTTGCCAGATGAAGGCCTGGCCACCCACAGGCGCTTTTGTTATT
 938GGATCGGGTGAATACATTCCCCAAAGTTGGTCATAGGGACCAGACTAATGCATCATATTG
 939CGTGCAATGACTCTAGGAGCGTCCACCAAATGGGATGATCAAACTATCCCTTAACCGGCG
 940GAAATATCAGGCGTGCTGTATGAAGCCATGTCTTCGAATATGCCCATAGGCCACCGGGTC
 941CGGACTGCTCGGTTAATTCCCGTCTATCTGGAAAAGTGTGTCCTCCTAAAGCGCGCCCGA
 942AAAAAAGTGGGGTTCAAACACTCTATCCATGAAGCATTACCGTCCACCCGCGCGCCCGTC
 943GCGGTTGGGGAAATCCAGGCCTTGCAAGTTACAGTTCCGTAGTACAGCTAGAACGCGGAC
 944CAGCGCCTGTGGCGTGGCACCGCCAATGGTTATCCCGGAACGTGAGCTTCAATGGTGCCA
 945AAATCGATAAAGGTATCCGAGGAGAGCGTTTTTTGCCGAGGAACTAAAGGAAACGCTATT
 946TGGGGCTTTACGACTAGTAACCACGTGCTGAGATAGAAGTATCACAATTCTAGTGAGACC
 947GGTTCACCATAATGAAGCTGGGGACAAACCCTTCGACACCTGCGACGGGCAATTACTACA
 948GGACTGGAGTCGCGACATAGAATATTCTAGTGATTAGCAACGGGATAAGATGAGGACTTC
 949CGTGGTGAAGACATACGACAAAGAGCAAATCGGCAAAGAAAAGCTGGCGTCGAAGGCTGC
 950GATACTACCACGCTTACCGTATCATATATCGCCCGGCGTGTCAAATAGAGCCGTCCTAGG
 951GATTCCGGACCTGCTTCTCCGGGACACAATGGTGGCTATTCAGAGCTTCAATGTTATAAT
 952ATGTCAAAAAACAGCGAACCAGATCTTATTTTGCTTCTACTATAGAGGCATCGTATGTTG
 953TGCCAACCACTTCGTTGGGTGCCACCTTCGCAATCATGGTTCTATGACAGCGTGGATCAA
 954TCAAAGAAAGTATGAGCAACGCAGTGGGAGTTATTACAAGGAGGGGATTACCCCTATGTT
 955AGTACGCTGCCCCTTACTTAAAGCCCGCTCAATTAAGCTATACATAACAACAATCGCTTA
 956ATATTCACGTCCATGTTGATGGTTCCCGAATCTTAGAATTACAAAGTTCATTGGGTTTGA
 957TCCTACCCGCAGGAGGTCCACATTTGTGCCGCGTAGCCTTGTCAATGTAATGAGCTAAGG
 958CATTATGCACATCCTCAGAAGTGGCAGGAAAGATCAGTCGCCCGGCTGTTTCGCTTCCCG
 959CCAGACGGCACGCGAATTGGGCTATTTAACGGGGATAGCCGGTACTAAGGTAAGATCTTG
 960AGATAAGAGTCCGACTTCTCTGCTCCGGCGACAAAAAGCTGGAATCTGGGACCCCGTTAA
 961CCCCCGGGATCGCCGAGCTAATCCAGTTGTTTACCGTTATGCGTGAAAGTAGGCTGAGGG
 962CCCGGGACCACTCTTTTTTCGTTAAGGAAAGGGAAAGAGAATTCGGACCTTTGGTGCGTC
 963GCTACTCATTATGTAAGACTTATCTGAAATCTACTGAAGATGTCCACTATTATGCGACGC
 964AAACCTTCACCTTCCACGACCTCCCTTCAGGCGGGTGCAGGGCCTGCACCCGATTCGTTG
 965CCTTACGGGGAAACCTATTCACTCATGGGCATTAGTCACAGCATGGGGCGTCTTGTGCCA
 966GCTCCCATCCTTGTGCCCTGTTAGGGCATGAGTTTCAAACCTAAGTCAAAGTTGCCCGCA
 967ACGTAGAAGACTTGTGCAGCCAAATCGATTATCTGCCTGTTTGTCGCGGTTTTTAGAGGT
 968CTGGGCATAGGTCAGTGTCCGCAGAAACGTAAGTGAAGTAACTGCGCACGCATCGAGGCA
 969CCATATTACGAGTAACGCCTTGTTTCTCAAGCCGCGCAGTTTCGTCTCGAACGAAGCTTC
 970TCTCAATCACATACGTGCAAGCGACGGGGGACTTGTTCCTTCTTTCTCGTGAAACCGTAA
 971CAGCTAAGGCCCTAAGCTTATCATCCCACCAGCGTATAGCCTGAAGGCGGCCTGACTCCA
 972GCTTAGTTGCAACGACATGGCATAGACCCGGAACTATTTGATGCCGGCCCAGCTTTTAAC
 973TGCTTATTTGCACTCGCATTCTCGTACGCCTAAATTCGGAATACGGTAGGTTGACCCGTG
 974TTGTTCTATCCTCCATTTTCCGATTCAATAGTTAGGCCTATATACTTCGTGTCTTAATAA
 975TGTGGCCTTATGAGGCCCGTACTGAGGACTACCTTACATAATGACAGTCAGGCCACTGGC
 976CGGTGCTTGGTGCCTTCCGGCAATGAACTGGACATTGGGACCGGGCCTGTCAAGTGGTTC
 977GGGTGCGAAAACCTTTACGTATTACGGACGCTATGGCATCATGCGCATGGGTGCTTTGTA
 978ACAAAGGCTCGTCACTGCGAAATGCTCACCCCGCCGTTAGCGGGTTCCAACAACGGAAGC
 979CTGTATCAGCGTAACTTTAATCATGTCGTATATCTAAAATGGGGTACGTCGGGTCCGTTC
 980TTCGAAGCAGAGCGAAGCGCGCTCACGGACTTAACCAAGAGGTTATTTCGATTAATCGCC
 981AAAAACCACTAACTTGTTCACCTACATGGATGATTACAAGAAGCAGTTCATGGGGTGCGC
 982CCTCCGCGTCATCTACCAAGATAGGGGATACACCCGTGAGTCCAAGGCGGTGGTCACTAA
 983TGAATCTGTTCGAGGAAACGTACCTGCACCAATAAGCTCATGGTACACCCTAGACCGGGT
 984AGTTTAGATTCGCTGCAGGGTGGCGATCGCAGTAGGAATTTAGATACAGAGCGATAAGCT
 985TGCGGTCGTACGATGTTATCACTGGGGGAACTGTCAGGGGGTAGTTGGTCATTTCCCTTC
 986TCACACCGATAGTCCGATATAAGTTTAAGACGCCTCTCTTAACTCGCCCGAGGGCGCGGT
 987GACTCCAAGTTGTCGATTCCCCTATAGAGAAAACTGGTGATGTGTCTGAATGGGGCTAGC
 988AGGCTCTGCCGATCGGGCCTGACATTCGTTTTCCACTTTACCAATGTCAAAGACGTATCT
 989TCTAGTCCTACAGCACATGATTGAAATCTCAGGTTATAGGCTGTCGACGGCCCTCGTCTG
 990GTCATAAGAGACGGATAAAGTCAAACGTGCCACGAAGCGTTGACACAACATACTCCATAT
 991CGTGAAGTCAGAGGGGTGGCTCCAAGGCGGATATCCTTAATGCCATTACCCATGCTCTAT
 992CAGGATTTGTACCCGCACCCGGGCCTCGGCCTGTCGGACATCCAGTGGATAGGGATCCCT
 993GGGACAGTAATACAAATGGTGGCAACTCGAACGTCTTAGTACTCCACAGATAGAATGTAA
 994TCCCATATTGGTTGAAGGAAGTCAACTGCAGACAGCTGAGCGCAACCGTCTCCAGCCCTG
 995CCTGCCTATTGAGTCGCGCATAGAAACCCAATGTCTACATAGAGGCCTTGTGGCTGCATT
 996CTGTGTGGAGGCCGTTTAGGGCAATTGAAGTCCCAACGGCCAGGGGCCGTTCAACTTAAT
 997GTATCATGTGTAGGGCATGGGGTGGCGCCGCTCCGGGGACAACGGTTGGGAAAAGGCATG
 998GACAGTGACTCCTGACCTTTCTTCTCTAGTGATTACTTCAGGGCAGGCCCATATAACAAT
 999TTTGGAACTCGCAAGAGAGTCGGCGTCTTGGGCCATCACAGTCGTTGCTAAATTGCGTAC
1000CGTGTTGCATCGGTACGGGGTGGGCATTATACCTAATGCTCTCTGCAATGGGACAGCTCC
1001GGTTCTAACCTGAACGCCTCTCTTGACATTCGCACGTCTATGGTTTGAACCTGCTCCACA
1002TGGATATGCGTAACATCGACTCCCGAGTATAAGGACGTTACGAGAACCGCGCTTTCTCCA
1003CCATTAAGATGCGGTGTCTCGCTCCGTATAAACATACTGCTAGCTGTGTGTCTGTAAGCA
1004GCATGATTTGAGGGTCAGTTATCACAAGGCGATGTCGGAGAAATGAATGAGTTTTATTGC
1005CACATACCTCTTCAGTATGGTCCGAAGAACCCCTCATGGGTCGACATCTGAGTCATGTTG
1006ACTCAAGTGAGCCACTAAAAGAGCGTCAGAGGCCTCCCCTCTATTCGTCGTATGCCCGCT
1007TTCAAAGCGTATGAGCCAAGTAGGGATTGAGCTTGTTAACTACCATGCAGTTGGCAGATA
1008ACGTAAGAAGCTGGAGGGTGAGCTAGTGGTTGACCCCTCCCGATCACTGACGGGCTACCG
1009AAAACCCGAGTCCTAGTCCCCGATACGAGAGGAGTGTAATTAAATAGTCTAGCACCGACA
1010ATTACGGAGTTCTTCGTTCAGGGTGTAATCCTAAACGGCACAGATTTGTAGCGACCACCT
1011TGTTGTCACGCTTTTGGGCCTTTCAAGACATAGGACCCCTTGGGCCCAAGCTCAACATCG
1012TCGCTGGCTAATGGCATGATACGGGTTGGCACGTGCCCGCCGATACTAATTACGGTCGCT
1013TGACCGGGTCTATTAACTACTTCACATGGACCGCGTAAGTCCACCACGTCTGAAGGACAG
1014GGTATCATGGTTTTAATCGGGCCTGTCGCCCTTATTGTGACCTCAACTCAGACTTTGAGT
1015CTGCTGACCGCTACAACCAGCGGTCCGTCATTTCATTAACGGAGTATACTGTCCGGGACA
1016CATAGTTCTAGCGGACGTCAGTTTACCTCGTGTGTCCGGAGCCATCCGAGGGGCCGGGCT
1017CAGAGCCTTTTGACGAGAGTGACACTTTCAGGCAGTCTTCTGTTTCTGCCCACGAGCTCT
1018AACCAAAGTTTGGGGCTCTCTACATCTACATCACGCCGTAGGTAACCTGCACCCGATCCA
1019CACGCTTGCGTTAGTATCTCGATTCCAAGCATCCCTAACGGACGGCGCGGTAGGTTTTAC
1020AAAGGGCGGGACTGTCTGTCAGCGAACTACAAGAGAGTGCGTGCCCGATCCTTGCTGTGG
1021AGTGTCGCCCGTAAACGGCCAGCTAGTGCCCGAAATCTAGATCATCCCAGTAAATAGGGA
1022ATGATGTCCTTCGCCGGGTGAGGAGGACATCAGTAGCTTTTGACTGTGATACCTCACGCC
1023CGGTCGCGGACCTGGGAGAACCCGATGCCTGGCACGTTCCTGGGAACAGCCTGGGGCATG
1024AGACGGACCCGATATACAATCCTAACGCCGACAATGGTATAGATTTTATATACGACTTTC
1025CTGCTCTGATCAGCACATCTTAACTAGGTCTAAGCATCGAATAGCATCAACTCCAACTGC
1026AGCCATCTATTAGATTAGCATGAATAAATGCAATCAGGAGCTGTTCTAAAATGATCCTCA
1027CTAGGCGATGGAGAACGTCGTGCCGAGTTTAAGAGAGCACTGGCTGTCCATAGACCATAT
1028GATCCGCTTGAGAGATATACTTCGTGTTCTGAAGCCAGATAACCTCATACCAAGGACCTG
1029AGGAATCAGCTGGATCGAAGCCGCAACCCCTGTGGTCATTCGGTGCAACCTGGCAGGCTT
1030GTCCCAAGATGCCACACCATGTCCCCTTTTGCGATTATCATTCATGACACAGACTCTTAG
1031GTTATGTTGATCAACTTGATTACTGCCCACTGAGGTCCGTCCACGCCCTCAGGCGAGTCG
1032AAACGGATTTGCAGGGATTTCTGTCATTTAGTAGAGCCGAAACATATTTGGAGATTAGGT
1033GATGTTCAATAATGCGGACCGAGAACTCAGAGGTCCTGCTCGAAACTGCATTACACTTGT
1034CGCAGGCCATACCAGCCCTGCGGGAGTTCCGTTTTCGAGGTTAATGCCTATATCGTTCGC
1035GAAGTTTCTGATCATAGCCCCCCAGATGCCTACTGCGCGCTGAAGACACGCGTTTGTGAA
1036ATACGGGAACCTTGAGGCGTTACTTACGTCGTATAGCTGCATCTCCCTGAGCAAATACCT
1037GTGGGTAAGGCGGGCTTTTCTCTTCTGGCTCTGAGCTGCCCGTTCAGATCGGTCCAATGC
1038GACCATGTCTAGCTCGTATTCCCAGTCGGTACTCGTAAGCTGAACCTCCGATTCTCAATT
1039ATATAGTAGCGCAGCCTAGCGGACATGAAGTACTTGCGGTAAAAGGCGGATCGTGGGCTG
1040TGGAGGGTACTACTAACGGAGCCAATTGAGCTATAGCGGGTCGCATCGCTGTATTAGGGT
1041ATGCTGTACCGAGCCTAGCCCTACGTCAGATGTGTGATTCACGTGTGGGTTTGTCATGAC
1042GATGGTAGGTAGCGCTCTGTGCTACAAAGCCCCATTTTCCTCAATCTCCCATTTAATAAG
1043CCTGCGCCCTGAAGAAAACCCCAACAAACAGGCCCTTGACCGCGCGGCGTGTAGACTAGA
1044CAGGGTCCGCGTAACCGTGAGATTGTACAGCCTATCTCGCGCCGCGTTGCTACGTAGACG
1045GTTCTGGGTCAGGCATTAGCCCGTTCTCCATATGCGCACACCGTGTGCTATACCTAGGGA
1046TCAGACCCCGCGTACCTTGGTCGAGGCCATCTACGAGTCACTGATACGTTATCGTTAAAC
1047TCAAGGACCGCGCTGATTGTTGGAACTCGAGCCGCACGCGAGCCCTCCTTAGCGGCTCGC
1048CATTTATAGAGGGTTTTAAGTAAAGGGGTATCCGAATTACTGACGTACACTTCTAACGGA
1049GCCTACTTATATGAAAACCAGATTTTTACCAATGTTTTGAGGTATAATCCTTCGGAGGAT
1050TCTGTTCGGTGAGGCCGCATTTGACACTGCTGGGACCGATCGATACAGGACCTTGCATAG
1051ATATGCATTATATTATAAGGCTAATGCTCGCCCGATTCTGCGGACGACTGTACTAACGTG
1052ACACTACGCAATGGTTCTAACTATTATAGTTGATATTCCCCCATTTGATGAACATACTCT
1053GAGGTGCGTGTATTTGTCTGTTGAAGCCCGATGGCCAGTTATTTGGCCTATGAGTAAACC
1054GCAAACCATAATTTGGGTTCATAACTACTCGCGGCGTGTGGTCGGTAAGTGGGGGTCGAA
1055TGCGAGATATCGGGACCACAATGGCCGGTGGTCTCCCCCCCGATCAAGCGGCCCTTGCCC
1056AAACTCGCTTGAGGTTTACAGACTCAGTGAAGACTTGCACCTCTCCGACTATTCGAGCTA
1057CAGCCCATGCCTAGGCTAGAAGTTAGAGTTGATACACCATGCTGTCATGGTGATCACCGA
1058CAAAACCCGCCCGATCCTATCACGTTGAACACCAGGCTTTAAAGAATGTACCATTTGCTG
1059GTAATGGACCTCGATGAGATGGAGCTCTCACTTCTGTCGATGCCGATGTACCGGATCCGG
1060GTGCCCAATGCGAGTGTGAGGGTAATTCCCATCGAGTAGGTTATGTGCGGTAAGCAGAGT
1061GGGTAGCTTTGGTGCCGTGAGCAGTCTCGCAATGTTCAGATAGGTTTCTCCCGCTGTGTC
1062TACGGACTAATTACGTCCAATCCCTATGTTTGTACCAGCAGATTGCGTTTTGAATTATCT
1063GAGCATGACTAAAATGCCCAAAGCAGAACGATGGATCGTGGAGGACACTCGTCAACGCCT
1064TCGCTGAACATTACCATCCGGTCTAGAGTCGGTATGTATAAGTATAAGCCATCGGCAGTT
1065TCCGGACCAACAGAACAAACGAATGGAGATCTCGGTTTATTCACCAGCCGGTTGGCAGAA
1066CCTGACCTACGTGGATTTAACGTAACGATGAATATTCAGGGCCATGAGCAGGTCTTGCAC
1067TAGGACGGCAATCCACTATAAGTTTGTGTTTGTCAAGGGATGTATTCTTCTATGTGAGAT
1068CACCCGCAATATCTAATCTGGTGCCGAGAACGATTGCAGCTGCACCAAGATCTCGATGGA
1069TAGTTCCACTCACGATTATGAGTTACATAGTTGCGCGACTTTTCCTACATTAGGAGTACT
1070GCGCGCGCCAAATACATCCTCAATGACGAGCGTATGCGTGGTGCTACTCTGGTGCGGGAG
1071CCCACAGGGCAACTCATTTAGGTCAATTTTCACGAGTTCCACGCATGTGCAATTGATCTG
1072CAGGTTAGGCTGTCATCGTTTTATGGTCTGAAGGGCCTTTATGTAGTCAGCTCCGTTCAG
1073TATGTCTAATACGGAGATAACCTGGGCCTGTTGGCCAAGATGCCAGAACAATCTCTCTAC
1074CTATGCCGCTGCCAGCGGCTGCGTAAGGTGTAGTTAAAGCTAGAACCGTGGGTACAAAGT
1075GCTAATAATGCTTATTCCGATAGTAATCACAGGATGTTGGGTCCTCAAGGCCGTATTTAT
1076AAGGACATAGGGGTTCAAGGGTACGAAGAACAATTCATACGGTAGTCGTTCCGCGCCGTC
1077GAGTACAAAACGTCGCAATTTAAGCTTTCGAAGGTGTTTATAGGCCTCCTAATCGCACAC
1078TACGTAAGTTGTACCCGCTTATTTAGAATAGTCTCAACGTCCGCGAGACCTCCGACACGA
1079CATGTAGTCCTGGCTACGAGTTTACAGGCAGGACCTCTTGAGCGTAGCGGTGCTGTTACA
1080ATGAATACTTTTCAGACACTTCCAAATTAATCTCCTCCAAAATCACGCGTCCAGCAGCTT
1081CGACACACTCCTCACCGTTAGACTGGTCTTACCAGCCGGATTAAACGGACGGCTCTCCAC
1082AAGCAATGGCGGCGGCTATTCCGGATGCAGGATAGTACCTGACTGTAGATCCATAATGGT
1083AAATCGTCTAACACCTCCCCCGGCGGGCAAACAAACGTTCATTACATGCATGTCACAGGA
1084GGCGTGACCTTCGGGTGCCTGAGCGGGGAAGGGAACGATTTGCGATCGATCGTTTCCCTC
1085CGTAGACAAATAGAGGTTAAGGGGCGTTTTACCACTAGTATGACTGAGGAGAGCGATGTG
1086CTTGTACTTAAGGATCTTACAGCGTAGGGCCTCACACGAAGAGAACGTCGACAGTAGGGA
1087TTTAAACCGCCACTACAGCCACGCTGCCATCTTAATACAGGCGTATAACCGGTATGGAAG
1088TCGGGGCGTCCCGTAGGATAGCGCCCTACTGACATTGACCGGGAGGTATGACTGGATCAA
1089CTCGTACGAGTGCGTTAGTTAAATGGTGAAGCTTTGTAAAGAGTGCGGTGGTGGGACGGC
1090GCGCACTACAATAGTGACATTGTCCCGGTATCCCGGGGGTGGGGACAATAAGTTAAAGGA
1091GCCAGAGAGATAGCGGTGTGGTACGACGGTGCAACGATGGTCGCTATGGGAACAGTCTGT
1092TAATACGAAAGTGAACAATGGTTATCTAACATGATGGCTGCCGTGGAGGTCCGACGCAGC
1093GGCATAGCCCTGTCGCAGTGGATAAAGCCCTTTATGACTCTTTGACTAAGTGTGGTTCCA
1094GATCAGAATTCGGAATGTTGGGACCGAATCACCTTCCTCAGGTCTTACTTTCGTGTCGTC
1095ATGCGCTTAATTTGAGGATCTGGCCAAGGTTGGGAATTTATTTGCTATTTAGCGAGGACC
1096AATGGTTGGGGGCCATACGTATCGCCAAGCCGGAAAATGGGAATCCGCGCAGAGACTCCC
1097GGTATACTTTCCAGCCTTTCATTACAGCCTGTGGACGCACACTATAGGTCTAATAGTGTA
1098GCTATTCCACTCGGCGGTACAACCTGTGAGGGTCGTCTACATGTCACTTCCACGCAAAGC
1099GATCGGATCCAGATCGTGCGTGGCCTCCTAGCAGTGATCCAGTCCATAGAGGTCTAAACA
1100AACCGATGACTATTCATAAGCGAATTAATCAACCCTGACGCCGAAAATAACCTCCGACGA
1101TGAAACAGCCATGGTGGAGTATATCGGCTACGTCTTGTCAACTTTGCGGTCTTCGATACT
1102CTCAAATTTATACGTAAAGTATGTCATACATGTCGACCTCCGCGAAGAACTAACTCGGGT
1103TCCGGTGAACCCTGTTGCAGGTTTCGATCGGAATGGGCGGGTTGCGCTTCGGCCCGTCCA
1104ATAAGTGAACGGACAGTGCGTTAAACGATTATGCTAACAAGGGTTTCGCGCAGCCGTTGG
1105TTCCAAGACGAACGTACATGGATACATATCGGATAATGACAACCTAGAACTGCGTGGGTC
1106TCAACAAAGCCGCGAAGGCGTACAGAGAGCCCTCCACGATTGGAAGCTAGCTGGTAGCAA
1107TCGGTTGACGAAAGCCAGAAACTGAGGGTGTGTCAGAGTGCTGCCTGCCGCCAATAGCGC
1108TCATGACTTACATTCATACAGGGGGCGATCGGGGCCGTACTCCTATTTTCACTGAGTGGG
1109TACGGGTCCTGCAAAATTAGAATAGTGCGAACCCTTTGACCTGCTGGGCGAGGTGATACC
1110ACGCGGCGACTGACTTTCCATCGCCACAATCCATGTCTCGCAACCTCACGAAATGCTTCA
1111GGCTCTGTTTCATCCAAGACCAGCTAGTTTTGCACGTTCGGGGCTACAGCCTCTACTGAT
1112CTCGTGCGCGCTCTAATCAGGGCTCGACAAAGTCAGTCCAAGTCCTCCAGTGAACCGGGT
1113GGCGTCAGTCGTTCACACGATCGTCACAGTTAGAGCCTAAAGTAATCACTCAATACTCCC
1114AAGGAAAGTAGAGGAGCCTGAATATTCTATAATGTATTGGTAGCGGAATTGTTCTGACCA
1115AGCTAATTTCGGGATATTAGGTGCACACGCCGTGGAGCTCTCTCGTCCGGTCCCGCTGGC
1116AAATGGTCTTGGAGTGCCTTTTAAATCTCACCACCGTATGTGCAAAGCCGAACCACAGCC
1117GGTGTAAGAAAAGCAGGGTTATACAATAGAGAGCGCCTTCTTCCCCTTAGGACGGGTCGC
1118CAGTCAAGTTAGGCTTTGGTACTGTCAGGGATTGGAGGTGCTAAAATTGGGTTGCGTCCG
1119TCCGTATCGGTACAACATCGCTCACGTCTATTCACAAACTGCTTCTCCGGTACCATTTAT
1120TTGATTAAAGTGTGGACTCTCATGCACCTCATAGTACAACGTACCGCGCGCGGCAACGCA
1121TCTATTAATAGCTGGAATGCCTTTATTCCAGCCCCAACCTCTAACGACCGGGCCGGACTG
1122GCTTTAATCCTGATGCGGGTAAGCCATCCTTTAGTTGTTTAGCACTCTCTTCTCTACGCG
1123CCGGTCCGAACAGTAAGCTAAGCTTATATATACCGCGATGAAGTTGTGTGGTCTGAACCT
1124CATTCGATGTCGTTCTCACATTTAGCAGGCCTCCGGTGCCCGTCCCAGCCGAACAGGCCA
1125GGAATGGGCATGGTTAATGCACGAGGTCTACGGCGGAAACAATTTTTTGCATGGTCCGGA
1126GTGCCATCCTGCTCAGATCTCGGTACACAGGGGATTCGAGGGTCTAAATCTATCAAGACG
1127TTCCAAACTATCGGGCGGCGAAGTCGTATCGGATTAATCTTAACTGGCCATCAGAGAAGT
1128CACCAAGATTTGATTTCGAGGATGGAAGAGGCTTGTAATTAGGACCTGTTCCTAACAAAA
1129TGCGCACCAACAGTATATCATGCGTCATGAACGCTTCACGAGGGCTCCGGCCCTAAAATG
1130ATTGCGCGGGAGATACGCTAAAGCTGCAGAGGAGACACTTAACATGGCTCCTCTACCCCT
1131GTCGCCTGTGCTGGTCACGAGATATACCCGATCGCTTACGTGCCACTCGCCCCACCAGGG
1132AGCCATAATCGGTAAACTCTAGAGGCTTTCCTTGCACCACTGTGGTGTGTTTCTCACATA
1133CAAAGCAAGACCTAACAGCGGACTTGTAGGCTGCACGACACGGAGGCGAGCGGGGGCCGT
1134ATTGATTGTATAGCACTGTTAAGTTACACTTCTGATCTGCACCGGGTCATAATGTGGAGA
1135AGCTACGGCATCCATTGTAGGCTCTGAGTGGTATGCCATGCGTGGGGCCGTTTGCTCCCA
1136TTTAGCCTCACGGACATTCACCACTCAAGCACATCGAGGGGTAAACCTAGTGTTTTATTG
1137AAAATCGAAAGGAGTAAATAGGGGGCCGAACAACAAGTAGTGCTAATAAGCGCTATCCCC
1138GGGGTGGGCGACACACCACCGGATGAGTGAAAGGGGCCAGTATAGACTAGCGCCGTCAGT
1139AGTTCGCGTCAGCAGTATTAGAGTCAGGCAGCGCATTCCGGGCAGTTGTGGCGAATCGGG
1140GATACAACCCTATAACATTTGCAAGAATGGCAGAATAAAGGAGCAGTACGTTATAGTACC
1141GGCAGGTTGACAATGACCCGTAGTAGCTGGCAAGATATGTTTTTGCATGCCGCTCCCTCT
1142CGTGATCCTTAGGTGACGTTTACAATGCGTCTCACCAGGTCGCTGTTTCGGATACTTTAC
1143GCATGGAGATCGCGCTGCGTTCAGCCCAAGCGTCCCTCTAAAGGTTCCAAAACAGGCAGC
1144GTTCAATAGGAGTGAGCGTGGTGTAACCATTGGGAGTTGCCGTAAAGGGCAACGTCGAGT
1145TCCCACTTAGAGATGCTCTCGTCTCAATATGTAAAACATGGTAGTGTGTGAGCCCGGGGG
1146CAGCAGGGGCAACATAGGGGCGAGACCGTTAATGGACAGTCGAGGTGACCGGTGCTAGCT
1147CGAAAGACGGCTACGGAATCCCACACAATGTAATAACCGTTTTAACGACCCTTCATGATC
1148GGCGGGTTTCTGAGGATCAAGCTCTTACATTGGACAGATCCGACAGCTTCAGGTTCTATT
1149TGCCGGCCGCGTTGAACCTAGTGCTGGGGCCCTGTGCATTCCTCATCCCACTAAATGTCA
1150AGCAAAGCCCCGGATGTATACCACCAATTCTATAATCGCGTGACGAACATGCAGGCGGAG
1151TTGGAGGCATTTCTATTAAAAGCAAAGTGGCGGTAGCGTCCGAGCACCCGCCAGCCGTAC
1152GCTAATGCGCGTTGGAGTCTCGAGCGTTCTATATTATCCCGTACCGGTGTTTGTCTCAGT
1153TTGTGGTCTAGGTTTACCATCTTTGAGACATATCAGTTTTAGCTCAAGGAGTTCGCCACG
1154AATAGTGCGCAGTCGAGGTAGCTCGCGTCAGCACCGATAGCACAGTCACAATCTATAGGC
1155GAGTCACCTCAAGCCAAGACGAATTAGTGAACCGAGGCAGTAGCCTCCCCGTCGGAGATA
1156CTCGCCAATAGGAATCAAGCCACGGTGAACCCAGTCATCTATCAAAGAAACCCGTTGCAG
1157GCTGTGTTCCGCATGATAATAGACATCGACAGGTACCACTCTACTGGGGGGTAGACGCTG
1158GACATCGCCTAGGAACTGACAGACACGGGCCCCGCCTTGCGGTCGTGCCGTGATTCACTT
1159GAAAGCCGCTTTCGATGTCTCACGTATACGTATTACACTCAGCCCCATACGGCAACATCG
1160CAGATGGTTCCTAGACTAAAGGGTGGATCCCGCTTACCAAGCTGTTTGTTGCGACAGCTT
1161TAGATCCAGCAAGTTCGGTGGGTAGAACGAACAGCATGACTCGCACGTTGCCAACGCGTT
1162GAAGGCGGATTTACCAGTTGCATCCCAGTTCCTCTGGGAGCTGCCTCTGCCACCCGGCAC
1163CCGAGCGCTGTAGCCTATGTAATCCAATGAATGGTATGCTACTGGCCTAAGAACCCCCAT
1164GAGAGGACAGAATATCCAACAGCATGCCACAGCTGTCGCCACCTCACGCCTCAAGTTTAT
1165CCCGATGCCTGGATCGAGACAAGAAATTAAGCCTTCGCGAAAGCTTTTGTAGTTGATCTT
1166CGAGCATACCAGCGTCCGATCCCCATCTCATGGTCATAACGATTGGATACTCGAGGATCC
1167AATGAAGTCGATGTGACTACATTGTCATCCACGATGAGCCAGATCTTTGTAGGTAGCACG
1168CGTTGGCGATACCAAGTTCCTGTCCTTGTCACTTACGGTGCTTGATATTGCGAATCATAT
1169AAATACAGTTAATAGTTGGGATAAAAGATGTTGAGGCGAACCAACGTAAGTCCTCCTTCG
1170CCCACTGGCTGTAGTCATCACACGATATGCGAGTATTGCACTTCCTGCGAGTATCAGCAC
1171TGCCCCCATGCCGAGTTCCCCTACGGGCTGGGATACACGTTTACTTCTAGACCCGTTAAG
1172GGCGCCACGGCCCCTAAATAGACTCAGAATGTCTCTACAGTCAATTCTTAACACACCGCG
1173CACTTGGAAGGTAGATCCGACGCGACTCACTCCAAATGATCTGCCGATTGTCCCTCGGGG
1174TGAAGACCTCAAATCGCCCCTAGACCCATAGTGGTATAGGGGGGCTATACATGGATTCTG
1175CGCTACATCGCTATGGGGCGACGGTGCGTCACTGATTATAGAATAGCGAGCATTGGCAAA
1176CACAGGTCGGGCTGATACCATGCGCTAGTATAAAATGAACGGGCAGAATGCGAGAGCAAC
1177ATCAAGTGGATAGCGTTGTGAAACGATAATCATGCTAACGACTTGCGGTCAAGCCACAAG
1178TCGGATCAATTAAGTGTCAGTCGCGTCTTGCTTACTTTATGTAGCTAACCGAGCCAAGTA
1179ACTACATATTACGATTTATACGATTCTTAGTATGAATACGTCAGCTCATCCATCTGTGCT
1180CCTATACGAGCTTCCAATAAACATTACGGGCTTAATACCATGAGTCGAAGAAAATTAACT
1181TGGGGGCTTTTGCTACCGCCCCGCCCAGGCCCTTTCGCACAAACTAGATTGAAACGCCAT
1182GCACAAGGCTACTAGGACTTACTCCATGCTGTAGAAGTTTGTACTTTTAGTATGCATATA
1183TCATTAAGTTCCGGGCCGACATCAGTACTTCTACGAGGGCCTTTCCAGTCTAACAGAATT
1184ACGAGCAATGGCGCATGCGGGCGGGGCGGAGGCATACTACGGGATGTGTCACTGACACAG
1185CGCTGATATTCCGTCCCCTCGTGCCGTCTTACCCATCTTAGAGATTGCACGTCAAGTTAG
1186GATTCTTGGGGCTACGATTACCTGGAACTATGATCCGATCTGGGGTAGTATACGGTGGAG
1187TAATTCCCGAGCGATCATTTTGTCCCATTCCGCCGATTCCTAGGACTAAGTACGCGTCCT
1188GTCTATTTGCAGCGACTTGACCAGACATGGGCCAACTACGCCAGAATTTCTATTTTATGT
1189CCAGCAAAACGCGGTGGTGCACGTCCGCACAGGAATCATCCGTAAGGTCAAGGGCTTAAA
1190CCGTCGGGTCAATTAACTTTTTCCGGACGCCTGTGTGAGCGGCCCGCGCACAAGGGCGTT
1191TCTCACCGGTTACCCGTTAATGATAGCCCCCAGAGGCTCTGATTCCCAACATTCTATACA
1192CGCTGTGAGTTATTTCAACACGTCTGCGTGTACAATTGTCCTCAGACGATGCCCGAATGT
1193GCTTCTGACGCGCGTTGACGTTAAAGAAGTTAATTGGCGATAGAGCTCGATCTTGAGGAA
1194CAAGTTACAGCAGAACCAGTACCACTATCATTATCTGCCGTGGGGTTATCTTGATTTTGC
1195ACAAACAGGCCCTTTGGGGCTCCGGACCAAGACGAGTAACCCTCCGTTCCCAGGGAGAGG
1196AAGCTTTGTAACCTGGCCGGGTTACCCTCTGCTATGTGCTGCAAAGGCTAACTTCAAGAG
1197CGTCGGTGCACTCCTCTGTGGTTGGAGGTGAAAACTGCCTCGTTTGAGATATGTCATTTG
1198GTTGTACGCGCTAAGTTGCTGCGAATCATAGCTCTTGCCTTGGATATGTCCCGACTTGTG
1199GCTGTTCCAGATATTTTTCGATTGTCCGTACGGAACTCGTTGTTCGTCCATCTTAGACCT
1200GGCAGCCGGTCCCACTTAAAATGAGGGGTTGCCTCACGGTCTCTAGGTGGTGCCGATCGT
1201AAAGAGGCAAAGTCCTTTGCCGAGTGGTTCGACGGCAAGCATTTAATATCCATCGTACGT
1202GATTGCCTCTACGTCTTATGCAGCGAAGCGCTGCTAGATATTCGGGCCGATAACCGGCAT
1203TGTCTGCCGCCCATTTCAAAAAACCCTTGATCGGGCATGGAATCTTAATAAAAACGCACT
1204AAAGGGTGGGAGGATCTTCGAGGAGTGAAATAAATTGGCAAGTGGGTCGCTGTGGCCCCC
1205CCGCCCATTGAAATGGCGTTTGCGAATGCCTGGCTTGAGGGGGGCAATGTGCCATGATAC
1206ATTGCGCTGTCAGTGTAGGGCCATCTCCGCGGACACTCCGCGGTGCGGTCACGAATACAG
1207GGCGTCAGTCAATTTCACTTGAAAAATACTTTCAGACGTATTAGGTAGCTGTTGAATTAA
1208TTAATGCCAACTTGCGCCAGCGGACGAACCAAAACAGGCGGGCCATTGAAACGGGTAGTG
1209TAGAATATCCCTTTCAGAGGAGATCGGCAGTAGGAGCACTCTGAGTAAAGGACGTGAGTC
1210ATCGCCAGCGCGCAGTTTTTCCAGATAACACCTGTATAGAGAGTACGTACTCGTAGGATA
1211AACTTCTGCGTTGCGGGACGCAATTAGGACGCCTAAAATCGGAATGGGGTATAATTACCC
1212GTGTTGATGTCACCAAAGGGGTGGTCCAGTCAGTTCCTCAGGATTCATTGGCCATCCCCT
1213AGTGCGAGGCGATTAGAAGTGACAAACCCGACATACCATTCGAACAGCAAAGACGAGTCT
1214CCCCACGGCGCGACGCCAGCCGACAGGGGTCTCGCCTTTACCGCGAGACACGTCTTACCG
1215CGCGCGTAGTCTATCGATGCAATTCGGCATTCCCTGTGTCCACCTGATCGACGTAAGGCG
1216CCTTGGCCAATGAATAGTTTGACATCACAGTCTGACAGGCGCTTCGTTGGTAGAAGCCTC
1217TTTGCTTGCCTATGTAAGAGATGTTTCAAAGTTCCCAATGCGGAACCATCTTACGTATTA
1218ACTTGAATATCGCTGCATGTACGAGCTTATTAATATTAGAATGCGATGACCAGTCAAATC
1219TTCAGCTCGCCGATTGAGAATCACACGCGCGCATCGCAATCCCCCATCTTCGACACTGGC
1220TAGATAGAAGTGAATCCTGAGTGTAGATAGAAGTACTGGTCCCCGCGTAATGTCCTACTA
1221TTACGATCTCCAGGCATTTTTGGGATCACAAAACGGCCAAGCAATCCTAAGTTACTATTC
1222TTCTATGGAGGGTTTGAACCAAATAGGACCCACTACGGTTAGCTCACCATGCTTATCTAG
1223ACGCAGTTAGGAATTCACTAACCTAGGCCGTCAGTAAGTCACCCCCGCGCCGTTCTCTCG
1224GATGGGGTAGACTCGAGACAGTGCGTATTCCCGATATCTTTTATCGTTTCACAGGGGGCC
1225AGGGGCGCGGCGCCCGAAGTCGACAGTGAATAGCGCGCGCTTTACATCACAGTATTGTGG
1226TCTGTCTCGCGCCCGGCCTGGTACTTACGGTGAGATATAGATACAGTGTGACCAGATGCG
1227CCACTAATTAGTTGCAAAGTTGAAGGCCAGTCTTGTTGGGTAGGGTGGTACGGCTATAGA
1228GCCGCACAGTTCACAGAGCTTGGCACGTCATTCCCGCGTTGGCGTCATTCGGAAAACGTG
1229GTGTATGCGCAATCGGGGCGATAAAAACGTAAGGAGCGTTTATGCCAAACGAAGAATAGC
1230TGGGAGACAACTAACCGCCGGTGGGGTCGCGCTATTGAAGACCAGGCATTGCGAAAGTCA
1231AACTACGTCGCCATCGCGGCCAGAAGAGCGGCGTAGAGCCCTGCGTTTGCATCTTCCATT
1232GCAAACGCTAGATCCCAAAGCCGGACTCCGATTCTAGGCCGTGCATGCAGTCTCATTTCA
1233GCACGTCACGGTGAAGTGTTCTCAACATACAGGAACTCCCATAGTCATTAGATTCTACTC
1234GTTATTCGCTTCGATGCTCATTCGTGGTTCACAACTTTCAGCCACAGGATGTTTGGCACA
1235CGCCGTACGCGAGTATATCAGATCTCTCCCCGTTTCGTGACAATAATATAAGATTACTCG
1236AGCTCAATAGTCTTATATTTATCAGCATACGAATTCTTCTCAAAACTAAGTACCCAGCTG
1237TCGTACAAACTCGAGGCCGCACGCGTCAACGTGAGTCTTCAGTGGCATGGCGATAGGCTG
1238GCGCGAATTTCACAGACTTTCAGCTGACTTAGAGTGGTGGGTGTTATATTTCTCGTTGAT
1239CACGGAACTGTCCCAACAACTAGGCACCTGAAGCGCCTGACCCTGCTTCAAAAGTCTAGG
1240GGGCTCGAAAACCCATTAGAATCACACAAAGTGCAGGGGGGTTTAAGTAAAATCACCCCC
1241CAAACAGTGACATATAACTAGTACAAGCGATTATTCACAGGCTCCGCGACGGATTCTGGC
1242GCCGCATCGTTAAGCCCTTCAGTACGCAAAGGCTAGTTTCGTCGCTAGGTTGCGGGCATC
1243ACACAAATATCGGGCACCGTAGCGAAACATTAATCATCATCCGTTTTCAGAAAGGAGTGG
1244GCGTATTTCTTGACCAACCATCATTTTCGCTAGCTGCTGGGCATGCTGGAGCCGACCAGT
1245CGAATTGAGAGCCGATATCGTTAAGACTAATGGTGCGAGCCAGGTGGTCTCATCACGGAG
1246GTAAGGCCTTGAAAGTGAGTATTTCTATCACTAGTGACTTACTACGTTGCGGCCCGCCCG
1247GGGGACACGAATCATTGTGAACTCGATTGAGATAGTCGAAGCTACGTTCCTGGGTCTTAC
1248TGCGGTGACGAATTAACTTTATCTCAAATACTTGCCCTCTGCTCATGGGCCGAGCGGCGG
1249GACCGGGAGATACGCGCTATCCCCTTTCAGTGGATATGACGTCTCGCGGCCTGTACGATG
1250GGCATAAGGCTAAAAGGCAATGTCCATTAGCGAGGTTGCCTAGAAGGTTGTGATACTTAT
1251CGCCATCTCGCCTTCTCTGACGTGCTTAGATTGAAGTCGAATCTGGGTCCTTTGCACAAT
1252ATGGTTCGATGAGATAGGTATGTGCAGGAGGCCATATAGATAACAACTGATCTGTAGCGG
1253TATACTAATGATGCATCGGTGCACTTCCAATTATTCGTGCCGATTCGATATCCTTAGACG
1254ACCCAAGGTATATAAGCGTATGCAGACACGTCTAGTCCCACCCACCTGTGGGATTGAATC
1255GGGGGCCTGTATACACGTTCCCACATAATTCCCATTCCTTATGAAGCGCATGCTACGAGC
1256TTTATGTATGTTCGTCAATGATACGATCACGTACTAATATCATTGGAGTAATTCCCCAGG
1257CCCCGCCGAGGCGCAATCGGCTGAATCCTATACCCTGTGGCATTCATACCTGACGAATGT
1258TCTAGAAATGGAGGTTGGTTAGCATTCTGTGGACGTGGTCAGGGACCGACCATGATCCGT
1259ACCCGAAAGTGTCACCCTTCAACTGGGTTCTAGACAACCTATGGTTTAGTGGTTGGCACC
1260CACTCGACTCATAGCTGCTAACTTCCCGCTTTTAGAGGGCTGCTCGGTTGTTTGTATATC
1261TGATTGTCCCTAAAACGGAGATCAGAACCTGAGGTCCTGGACGACGCACCGCCTCTAGAC
1262CTCTCCAGATAAATCGCGGGAAACTCATTAACTGACTCTTAATATAGATATTATAAAATA
1263AACAGCCCGAAGATTTACATGTGGGGGGGGGGGTGACTCTACGAACAAGATATCTCTCTC
1264TGACCGCGGGGGTAGACGATGAACCTGCAGGAAGCCCTATCGCCGTCTGCGACGGTCAAG
1265GGGGCTAGGACAGGCACGTTTCACAGACGATCGCTTCTCTTGTCAACGGACGGCTGTTTG
1266TTTCAGCCGGCCCATCCATTCCCTGACGTAAGTTAACCCTTGCATAGAACTCGCACCCTC
1267GTTCGTCTATTACAAAAGAAAAGGCGTGAGTGCTTTGCTTAGTCGTGGGGGGGAATTAGT
1268GCCAAATTCGGCACTGACAGTTAGTCCGCTCTCGTCTTAACGGGTCAAGCGCATTTACGC
1269ATACGATCTTCAGTGCATCGAAAATTTTACACCAGTACATCCATCGACCGACGACCTCAA
1270GACTATGCCGAGAACCTCGATGGCGTGGAGGTGTGTGCATTACTCGAAATATCGCAGTGG
1271GACATATCCTCAAGACCACCTCACACCGCTATTGTGGTTTGATGTTTAAACTGCAGTCAA
1272AATTGGCACCTACTGAGGAGGCGATGGGAGGATCACTCGCGCCAATATCCCAGTACGTTG
1273CCGAGGGGAATGCAGGTTCCAGCGGCAAATGGCAGTTACTAACGAAAATCCTTGCCTCCA
1274CTGGAACTCTGCTTTATTAGACCATTCGATGCGATGCCCGATTTTTTGGTCTAGTTCAGG
1275TATGCTAGAGAACTTAGTTCGAATGTGATAGTCCCGACAATAACTACGTATCATATGTTC
1276TCAAGCGTTGTGGATGACATCTAGGCCAAACTCGATTGGGCGCTGACGCCCTACCGGGGG
1277GAGTGGGCACACTCCCCGTTAAGACTTACCGTCAGTGACTCCAAGCCTAAGAAAAGTTGA
1278CATGCCGTGTGTATAGACCAGAAGACAAAGACTAAACGTTCGTCCTTCAAGGAGCCTCCA
1279ACCTCCTTTGGAACCCAATCCCTCTAGTGTTGCACGGACCGAGTCTAGATTCAGGATCTC
1280AGTCGAAAACGGCACTTGCTCAAGGTGCACGATCGCCGGCTAACACATTCTCCTTTGCCG
1281GTTCCCGGTAAGAATACTACATGCGCCCGGTACGCGTTCGACCACACGACTAACGGGTTA
1282CTAGCCCCCGTCTACACGGCTGCTTTGGGCGTATGGATTCCGGATAAAGGCGAGCAGTGA
1283CAACTGTACGCGCAGAAGAGACACTGCCCTGGTGATATTCGATTACTATTTTATATCCCT
1284ATCACCTCCGGTGCGTGCTCAGAAGCTTGAGTTATACGCGATCGATCGACTATAACCACT
1285ATGATCACTGTTCCGGATACAACAAGCCGGAGGTGCATGACGTGTCATCCACCGCCATGG
1286CGATCTCGGTGTCCCATGAATACAGTCGGTATCCTTAACGTTCCAGCTACTTGCTAAATG
1287TTCCAAAAACGAATCAGGAGATGGACGAGCGCCAGCAGGCTACTAGAGAAAATGGAACAG
1288GTTTTGCTATAATCTTTTCATGATATTAATGGGGGCATCAGCACTACGTGGTATGCGCCG
1289AAATGGAGCCGTTTCGTGAGATCCGTGAATGCTGACCATGGGGCCTTACTGCGAGATAAA
1290AGCTCCCGCAATGGATCTTGTGACGGGCTGCTCGGGTTACAAAGTCGAACTTTTCCCTTA
1291CATGTGAGCATCCAAACGACTTCTGGAACTAGAACTGCCTGCCTCCTGTTTGTACCGGCT
1292CGGCGTAAAGTGTACACAGAACTTGAAAGGAAAGCGCGGCACATGCTTGCAGGTCATCCG
1293TCGTTTCACTCCCCATTTGCAGTTCATCCATCCCAAAGAGCGTGTACGTATAGGTAGGCA
1294TACACCCCTCTCTTTTTCCGCCGTTCTGAAGTATTCAATAGGCCCAAACGTGTCGGTCAT
1295GGGGCCAGGTGACTCTTGTCAGTTACCTTGGCAATGCTATGGTACCTATGCTCCGCGTAC
1296CGGGGGATCATAGGATTTTGCCCGGTTATTGACAGTGGTAGGAAAATATTGAAATGTGGG
1297GATTCCTTAGTGATTATGAGCTTCTGTGAGCGGAGTCCTCTGATGTTCCAATTTAGCAAC
1298GCAACGATTTAGCACTTACCACATAACCAGGGTGTCATATGACTCGTATACTCCTCGAGG
1299GACGTATTTTTCTAAATTCGTGCAAACGCTATACCTCAGATCCTGGTCCATCTACTCTCG
1300GCCGTTCATACTCGGTACAGGTTCAAACTCTGGAACTGGTGTGTCATGCTATTTATTAAT
1301CTCATCCTTTGCGACAAAGCTGCGCCCAGCTTAATAGCTCACTTCATCACGTTTGACTAT
1302CAGCAGCGTAATCTGGTCTTGGGCCACGAGCCGAGGGACCACAGATATAAGTGAATCGGC
1303ATGGTAACACGCGTTGGTCGTTCCAGCCATGAGAGGAGTCAGGGCCCTAGCAGTCGCGTC
1304CCCACTGCCCGCTAAACCTGTCGCATTCGGGTTTTAGCGTTACGCCTGGGACTGTTGGAA
1305CGTACTCTATTTTAGACCTTTTATGTGAGTATCTTTGAGTTCGTCATGCGCCGGAACGAT
1306CAGTTGGGGACGGTCTAAGCTTGCCGCTCCGGCCCATTGCATTGTACTCTAATTCACGTG
1307TGCATGAGGTTGGTACTCAACCAAACACTAAGGCGCTTTCGGTACTGCCGCGTGGTTGCT
1308GCCAGACCTATCTGCAGTCTGTCCCTCACGTATCACCGGAGCCCAGGGGTCAGGCTCGAG
1309ATGTATACCTCTAGCACTGTGTTCCAAGTACTATTAGTGTGTTTGATTTGGCCCGTCTCA
1310TGATGTAAGGACCTATTTGGCATTCGGTCTTAGTAAGAACGAGTTGTGCCATGAGTGAGT
1311TGTCCTCATGCCGTCGCAAGCCCTCTTTTCGTTCACCGCAAGGGCTAGTCAAGGATCTGC
1312AAAACACGGGTGACCCACTTGTTACTTTGCATCATTAACTGACGCGTCAGAGCATTTGGG
1313AGCCGAAGAGCGGTAACTCCCGAGGTCCCTTCCATTATGACTGAGGAACCCGTCCCAGTG
1314GGTTTGTTGCATAGTTCTTGCACAGGGGACAGTAGGGCGAGGAGATCCTAAACCATTGCT
1315TGGTGACACTCTCCCGATTTTTTAAATTGCTGTCCCCGCGGGCTTGCACCTCATCCTCAC
1316GTTCAAGCTTTCGAACTGCATCCTATATACAGAATCACGTAGAGGCACTCGGGTCGGGCG
1317TGATGTAGATGCCGTTTTCGCTATGGGCATTTCAGTTTGAGACTGAGGATACGCACTGGT
1318GCGTCATCTCCCCGATGTCGGGTCTAGGGACACTATTTATACACTCACAGAGATTTTCCG
1319CGGTCGGACGTCTAGGCTTCCTTCTTAGACAGTTCACTATCAAAATGCGCGTCCAAAAGC
1320CTTAGAATTAGAATAAGGCATTTACTACTTGAGCAACATAAGACCACTGTTGGGGTCTCA
1321GTAACAAGATTACTCGATCGGAAAGTATGCTAATACTAATTTACGCTGACCGCCTAATTG
1322ATGAGGGGGGCGCCTTTGGTTTGCACCCAATATGAGAGATACCCTACGGTCGGTTGAATA
1323ATAACCGCTGAATCCGCGAACGGTCCGGCCGCATCCATTTCTTCCCTGTAGCGAATCGCG
1324AAAATCGTCCGGAGTCTTAGTGTCTAAAGGTGGTTCACACGGAGATATGAGCGCGCCTGA
1325CCGTACAAGAGAGGTTCTGATACCGATTTCTAGGTGTTGGTAGCGCAAATATTCCCCACA
1326CAATGTCGGTACAGTGATGAGGAGACTCCAGGCGCTGGCACCGCACAAAGATCACCCAGG
1327CAAGTCCCTTCCATGAAGACCCAGCCTTCCCGGGACTGGTCTACTGGTCGAGTAACCTAT
1328ACCGTGTTACGCCGGAAATCTATGATTGGTCTCGCAACTAGCCTTATAATCTTCGTACCT
1329CGGGCTGCAGGTTTGTTGTACATACCTGTCCATTGAGAGTGAGGTACTGATTAGTGATAT
1330ACTTACAGCGCAGTGCATAGTTGTGCCGACCAGAAGCACGGGGAGACGTGAGCGGTATCA
1331CGCTGCGTCTGTCATTCACAGGTAACTAACCCTGCGTTCAGTTTAGTCGACCGACTCATG
1332CATCGATCTACCAACAGACCAGGTTTGATCGCGGGAGCGGCTTCAACGAGTCCCAAAGAA
1333TTCCCTGTAACCTCTTCAGGTCTATTATCATATAGATAATACCTGATAACGTGCTCATCC
1334AACTCTAATAATCCTACGACTGCCTATTAAAAACTCCTGATGACTTCACCCATGCGTACT
1335ACTCGGGTGAACGAGCTTCAATATCCCAGGTGTGTGCGCTGCACCTGAGAATTAGAGACA
1336GAGGTGAAACTGTTTAGGCCGCACGGCAGGACTGTGATGAACTTAGATACAGGATAGCAC
1337TAGGTCATAGAATTAACATGCTATTAACCAGACATACTTCGTGCGGCAGAGTTGGGGGAT
1338TGAATTAAGTGATAGCGTCAATTTGCGAAGATAATTTTACGGGCGATATAATATTGACGA
1339TGTTGGTCCTTACCCTCATACTACGTTGACTTAGGGCCAGATGCAAACATCCGCGAACTA
1340TGTTAGCCTCAAAGCAGGCTCTAAATACATCTCCGGTATGCTGGGAGAGATTTATTTAAT
1341TGTCTCTGCGATGTCATTACTAAGAAGTAGGTACATTTCAGGTACAAAAACTACGACATC
1342GGCTTCGGCATTGGTTTTTTTAGACAATAAATGCGCTAAAATTGCGCACATAAGAGGCCT
1343CCGTTAAGAAGCTCTCTCCACCAGTCACGCATGGGCGGTTTCAGGTTCACCGGGACTAGC
1344CTATCGCAAATTGTGAGCGTGTCACCCACACGTCCATGAATTTCGCCCTTACTCGAGTCT
1345TGCGAGTTCTTATTCCAGGTGGCCTTCCGGAGCCACATACTACGTGTTAGTGAATATCCC
1346TGTATACTTGAGGCACTAAAGTGGTGGGTAAGGTTCTACTGCCATGCGGGGACCGCTCTG
1347CTATTTAGACCGTTTGCAATGTTAACCTGACTACGTCTCCATTTGGCTTGGCCCCCGGAC
1348TCATGTGTGTAGGAGAGTTCCCTGGATCTTGGAGCTCTGTGTGCTACCTCTCGGTCGTGC
1349GATTGAGATATGTCTGCAACCTGACCCTATCTTAGCCACAACGAGCGAGGCTCTTGAAGC
1350TTAGTGAAGCCGGTGCCCCTTGGCCGTCGCGGAGAAAAAGGCCACTCGAGCAATCCCATA
1351GCGGAGGATTTCAACCTTTACAAGACTCCGCTATGAGAACTTGATTCTGCTACTGCACTC
1352AACAATAGTATTACTTAAGTCCTTACAAGTGGATGAGGGCTCATGTGGACCCGAATCCTA
1353ACGAACAGTGAGTACCAAAACCCTGGGTTGTTTGAATAGGTGCGTGATGATTCATTGCTC
1354TGCTACTTCCGAATTTCTGATCTACGAAATCTCGGGTCCCTTCTGAGATAAGCTTGGTGG
1355GACTGACGCTTAGATCCCCACCTGAGCGCTATTGGGGAATTTACTTGACTCGAACCGGTT
1356CAGCGATAATTTGTCCTTGATTGTTTACCAATAGAGGTGTGCGACTCATTAGGGCCGGGT
1357GGGGAGATCGGTTATAACATAACTTGACATAGCTAGCACTGTGGTGGTTTGTTTGGGTTG
1358GACTTCCAGGTACGGCACATATGTGCGAACTGCACACTCTCAATGGAGTACTTATGCCGC
1359GCTACAATTCGCGGAACATAAAAAATGCAAGGGCGTGTGCACGGTGTAGGCTGCTTACAA
1360CTGTACTGACAAGGTGCGGTATGGACCAGGAACTTCAGAAAAAGGTATCTTCGCATTCTC
1361TACATCGTTGTTGTGATGAACTGAAGTTTGCTGGTCTCATTTGCTAGGTGGACAACGTCG
1362GGCAAAGAGGTCGCTCGCTCTCCAGGCACGGTATACAGCGAATGCGTTTGAGAGGGAAGC
1363GCCTACAATCGTCGGGACGAAGGAACGACAGTCTGGAGGTTCGATATTGCTGTGGATAAA
1364AGTGCGACAGAATTAGTTGCACTATCAGCAGGTGAAAAGAGGAGCCACAGGCAGCTTCGC
1365CATAGTCGTTTCCTTTAAACGGGGATGAAACCAAGTTTCGGATTATGATGCCCTACGGCG
1366GGAGGGCCCTTTTTGTGCACTCGACGGTATGGGGCAAGGCCCACAGAGTATTGGTTACGC
1367CATTGATGTCTATTCTGGGCGCAATATACGCGGACCCCTAGTACGGCAATGGAGTAGGAA
1368ACGTCAAGCTGTGTCCCGCCCTTCGGCACCACGTAATAGAACTGAATCGCGTACCGAGTC
1369ATGGGTGCTCCTGCGGCCTAGCTTGACGTATTAGCGCAAACCATGGCATAAGCTCTAGGT
1370TCGTTTCATCCATCTCTACGACACCCCCATATAGGACTACCCCAGCCCCTAGAATCGAGG
1371TGCAATAGGATTGATACCGTAGCAGAGACAGATTATGACCCAATCATGCCCCTGCGTTGA
1372ACATACGTCAAGAACCACACGCGGAAATTGTTTTGAACTGCTACTGTATTCCAATAATTT
1373GGTCGCCGGAATTCCTTATGTATTATAAGTAAGTGAATGTATGTATGTTCCGGAGGTGTG
1374CTGTGATGAGCACATCTGATTCCCCTACCTTTGCGAGGGGAAGCACGTTGGTTAAATACC
1375TAACGGCAAAGAAACACTTCCGAAGACCCGGATGGCCTCCTTGTTTTATTCACCCTGGAT
1376ATTTCCAGCCAAAGATCTAAGCCTTGGCATAAGTATCAGGGGGGAGGCGGGATTAGCGTC
1377CTCTTCTAGCGATAGTTAACGGCGCCAGAATCTCCGGAGACAAACTTATTCGGGATAAGA
1378ACCAGGGCGCCTCGTGCGGAGTGAGGTGTCGTTTTCGGGATAAAGTTTGCTACGATATCT
1379CTTAGGCAAACTACAGATCGAAGCGGATGCGTACTTAATAAAAACAGGTTATATCGCCCT
1380TAGTCCGCGGGGGGTAGCGCCGACCCTTTCGGCCCGGAAAGGTAAGAGTGTACTCGCCCA
1381GAGTCTCTTCACTTGTCGCACACGAGACTGCCGTATGGGGTGTTCCGGAATCAATAGTCG
1382CGTTCAGAGCGCTCACTTTTTGATGTACGCTAAGTCGGCATTGGCGTACTTACTAAGACA
1383CAACGATCGACCATTCGTCTGAATTATCAACCAGTTGGAAGCCGCATTTAGCAGCTGAAG
1384CGACATAGCAGTGTGTTCGTGAAGTCGCGGATAAAATCGACATTTCGTTAGCCGTAACCG
1385ACCACCCAGTAAAATTCGGAGACTTCTTGCCGGGTATAAGTCGTCCTGTCTGGACCCCAA
1386GCGATCAGCCACGGATATCTCACTCTAGAAGGCCGAGTGAATCGCCCCCGCGTGCACCGC
1387CCTGGGGACAACTCTCTAGAGTGCGTCTAACCCATTGCTTCAACCTGATAAGAGTGCCCC
1388CGGGTCCCGACAACCGCTGATTGTCGCTTTAACTGAATGTTTTAAAGCTAGGTAGCGTAC
1389GACATTAAGGTGCGGGGATCACTAGCCACCGTCTTCTACCGATAGCGACCCGTAGCGTCT
1390ATGCTGGGGTTATTACAGCGAGATTGACCCACCGGAACGGACTAATCCGTTGCTCACCCG
1391GCTTACTAGCTTTGTTCAATTTCCGGCTTTCGAACAGCCAGATCGGCTTCTGCATTTCTG
1392AAAACGCTTGTCGTTACATACGTGTGGGTCATCCAGTCCGTCTCAGCCGAGATCGGTAAT
1393CAGTCGCATTGGAGTAAACTCTTAACGAGGTTGCGAAAATTTGTCCTCGAATATTACCAT
1394TTGCCCCCCGAACGTGAGTGGACGTATACTTATGCATTCACCAGATAACTGTTTGTTCTA
1395ATATCCTAAAACGATGTTGATATGTCCGGCGTAGGCTGCAGCCACCGAAAATATGTCTCT
1396ATGACCCCTGCCTGGATAAACATCACCCCGACGTGTATATGCACAGGTTGTATTCTAGAC
1397CATTTCGTATGGATAACGAAATATGGGTAGACTTAGATGCGATGTTTCCTCGGGCCAAAA
1398GAGCAGAACGCTGCGGACTGAAAGGCTGCTTAACCATCACTGAGTGATTTCTTCGGTCAA
1399CTACAGCATCCTTCCGACGTATTTCCCAGGATCCAGTCGGTTCGAGCATTATGTTTAATG
1400GAGACGGAAAGTTACTGGAGCACATATTCTCTTTTAGCAGCGCAGGACCATGAAGTCGGG
1401CTCATCACGATAGAACGAGTACGACATGGCATCGTATTCCTACGAGTGGCGTGATTATGT
1402AGGCAGCTCGCCGGTGAGCTTTGCTCATAGGCCCGCTACAGGCCAATCGAACTGGGTTGA
1403CACGCTAATCCGTGTTTGACTATGGCCGATGGTTACGACGCGAACTAACACACATTGACG
1404TTAGGCTCCCTTTTTAGTATAGACGTAATGTGCTAAAACGCACATACCACAATACGTCGG
1405TCACCCCCCGTGGAGCCTGCCGCATGGGTCCTGCATGCCTTACCCAGGTATAGACCGTAC
1406ACATGAGCCTAAAGCCGTTCTGGGGTTAGTCTAGGTGAAAAAAAGGCACAGCGATATGAC
1407GCAGTGCGTCGTGGTAAACGATTGTGGGAGTGTACTGGCCATAGCTGGTTATGTCCCTTC
1408CTACTCACTCTTATCCTATGTTGGGTTTTTCAGCCCGCGCGCCGCGAAGTGGTAACATCT
1409GGTATCCCGAGCCTTGGTGATCGGCGTCGAAAGACCCGGTGCAAAAGGTCTGGCATAACG
1410ACGTCTAGGTGAAGAAGTTGAGAGTCCTCGCCAAACTCACAGGAAGATCTCCCCTCGCAT
1411TGCTGCCCGCTGTCGTTTGCGTGACGCTTCTGTAGCCTTAAGGTTCGGACTGAGGCATCT
1412CACAATGCGCCGTACGCAACCATCGGTGCACGAGTAGCCAGTTCTATAATCCTATCGGTA
1413GAGGTCGCGTCAGACCCACCAGTTTGCCAACGCAAACGCACGAATGCAGTCGCAGAGTGG
1414TTAATAACGCCAACATTCTGAAAGCGGTCAGCAGCTTGACTCCTTCGGTCATGCCTTAGC
1415AAGATTAGCATCGCACGTTCAACGCGCAGACTATTTTTCAACCGGGTACGGCGTATCCAA
1416CCTGCGCAGTAGAGAGATGCCAGATGTCATCCCATGGCGAAGGAAGGACACTCATAGGCG
1417GGATGTCCATCACAAGGGGATATAAGAGAGCGACCTAGACCCCTCGCAATATTTTTCAGC
1418GTAGACCAACCCTTAACCACCACATAAAAGGGCGCCTGCTATCTGCTTTAAAACAAGAAG
1419GGCTAGAAAGTACATTGTGCTGCTACTGGAAAGCATTATAGGATTAGCTAGGTTCTACCG
1420CCTTTTGGTCGGATCTTAAGAGATCCGCGTATCTTAGCGCTCTTACGTCGCCACCCGTGC
1421TGAACTATCGCATATTCCGGTTATACATAGATCATGATGCGTCCTACCCTTATTTTATGC
1422CGAGTACTTTACGCTCCAGGTGGGCCGGAATCTTAGTCCTACAGGTTTTGCTATCCATTA
1423AGCTGCCCGGAGTCACAAAAGCTGAATAATAACCTTTACCGCACGAGTAGTGTGATGATG
1424TTGAACATCCCTGCACCGAGATATCCGTCCGAAAACGAATCCTAGTCAGCGGAGGCTAAA
1425GGAGTCTCCAATCTTATAACCGTCACGAGGAACCGAGGCTGCGTCCTACTCGCATGGCGA
1426AGACTGCCAGCGTTGACCAGCCCGGAAAGGAGCATAGAGTGTCCGTGTCGGGATAGTCGC
1427TGTAGGCAGTTAGCGAAAACGGTGCAAACGGAACCGAGTGCGTTTCTACTCTCCGGCGTG
1428CCGCGTAGCTCGCACCCCCGAGCGTTAAGTGTACATAACGTGACGGGTTTCTCTCCGGCA
1429CATGCACCAGTACACTGTTCGAATTGAGAGGCGGTTGAAGTAGAATTGGGTATTAGCAAC
1430GTTACGTTTACGAAGATCGGACGTAGCGTGTCCGGGCCCACGGCGACGCTACAGACCGTA
1431AGCCCTTGCAGGGAACACTCCTTCCTGGCCGCAAGCTCTACCTACTCCAAGCTCTACCTG
1432TCATCGACATCCAACCTGGAGACCGAGTGCCCGCAAAACATGCTTTAGCGGAGACAATTG
1433ACTTGTTGTAGGGACCTCAATGAGGGGTCGCGTCCCAAAAAGGGGAACCAGCGGTCACAG
1434TCAGGCATCATCGCTCCTGTTAAGTTTTATCAACGTGGGTGCACGAGATATTCTCAGATG
1435TCGTGCGCTAAGCCTACCAACTTGGAGAAGGTTCTCGCGCGTTTAGTCTTCCGCTACGAG
1436ATCTAAAGGTTAGTTGCTTCGAGCCCCTTGCTCGGCTTTCGGCACAGTTCAGCGTTTAGT
1437GTGTCCAAATCGGGGTTAGGCGAGATCAATTGGCGAGGAGGGAAAGTTGGGTAGGCGTCG
1438TAACCGCACGGTATTACGAAAGTCACGGCTAATCCATTAACTTCGGCTCCTCTTGAAAGC
1439TTCGATTTGTATGTAAGCATTTAGGTGTTCATAGCACATTATGGTGTCTTAGGACCTTAT
1440AAGAGTATAAGATAGGGCTGATATACATCAGCAAGTAGGAGCAGCGAAAAGATGTTATTC
1441TCGAGATGTCGCGGTAAAAAAGCTAATAAGCTTATCAGTTACCGTAGAAGAAACACGTCG
1442CTCATCGTTCTTTAGGAAGCTTCTACAGAGACCGGATATGCGGAGATTACATACTCTTTT
1443CACGGTGCTGTAACCTCAGGCGCGTATGAGGCGTAAGGCCACCCGGAAGGGAATGTACGA
1444TACGTCGCAAGACTCTGCTATCATCGTCTCCTCGCAATCATTAAGGAATTCTCCGGACTT
1445GAGTGTTGTAGGTTTGCTGAGTTTCGCCTAAGATCTGCCCCAACTTTAGCAACAAGGCTC
1446GTTGGCCCGTGTTGAGCTGTCGAGGAAACTGTGCGCGTGAGAACTATAACACAATGATTC
1447GCCAGTCCGTCCACGTGGTGTTTTTGGTCCCTGGTACCCTATAAATTGCTAAGTAGCGCG
1448TGCCACCCGTCGGCTGAGCCCCGACGGGATCTGGAGTCACACAGGTCTCGATTGTAACTA
1449AATGGTCGCCTCGTAAGCTATATGGGTTTGTTGTGAGTGTAGCGCCGAGGACGTTACGTA
1450ATTGGCTAACAATCGCGCCATCCCAACCTCCTAAGGGCGGGGTGTCTCGACCCGGCTAGG
1451CTCCTTTCACATATCTAACTAGACCTGATAGATTCGTAATCAGCTTCTTGGTATACGGCC
1452GTCCTGAGGACTAACTTGGTACGAATGGCTTATACGGCAACCTCCAACGTAGAGTACCGT
1453ACTTCACTGCTTTGCATCCCACAAATACAGAATTAAACTGTGCGCGGAAACACCCCACTA
1454ATCTTCATGTCCGGTTCGTCGACTGGCGAATATATGCTCTTGCCCAAGGTTATAACTCAT
1455CTTATGTAGATCTAGACGGTCCAACAGACGTGCGGACCATGTACAGCCATACAACCATGC
1456CCTGAGGCTGACGAGGGTTGGTTGAAAAAGGCTCATTGATCAATATCGGAACTTTTATAA
1457CGCCTCATACGCCGAGCCAACCCAAAAAAAACGGGCTTATAGACCATGCAGGCTTCATGA
1458TGCCAAGATTTTCAAGAACGATACTTGTGATCTAGTACTTATGCTTATTCCTAGATCGGA
1459TCCGGACGCCGCAAGTTGGGTACAGCTTAGTTTCCCCGAGTGTTGCGGACATCGTTTTGT
1460CGGATTGAGGGCACCGGTAGACGCTCAGATGCCAGAAAAGGGTGTAACACAAGGGCTGTA
1461CCCGGTGGTGACATTTAACACCATTGAGCTGGCACTTTCTGCAGAAGAATACACATTACA
1462TATAAATTTAGCCTAGTGGTCTACAAATACATCTACTTCGATACGATCGGATCAACAAAA
1463CAATTAAGTCCTCCCTCACTGCGTGGAGGCTTCTGCTTTGAAGCCTCGTGCGTTCCCGAT
1464TTTAGCCCACTCCCGTATCACTGCGTGACGTACGCTAGAATACCCAAGTCGCAAGTTATC
1465TGCACGACCACAATCGTCAGTGTTGCGCGCGCAACCGCGTGTAGGCACTAAGGTCACAGT
1466CAACACGTTAGCAGTGAAATAACTTGTAGCTAGTCGCACAAACAGATGATCCTGAGCTTT
1467CGTTGCCTCTTCTAGCACACACGTAGCCCAAGTACCCTAGGTTCTCGTGGAGAGCAATCG
1468TCAGCGTGCTATGAACCGCACCGCAACATGGGTTCCCATGAACGACACTCCAGACGAGTT
1469ACCAAGCCTATTAACACCGCGTCCTTTTCGGGAAGAGTGCTCAAGGATTGAGGGTCCGCG
1470CTACTGCGCTTCCACTGCGCATTGCGTGCAAGACTTTACCACGCCTATAGAACAGGGGAT
1471GCCGGAGCCTGCAAGCTGAAACAGCTATCCTTGAGACACGTATAACCATGATTACATGTA
1472TGACTGCAGGGCGCCTGTTCCTAATGATATTTGTACCCCTTTCGAGCGCATGTTGGCGCC
1473GCAAAACGCGCCCGTCCATGAGCTCTCTGTAAACAACCGTTAAAGTCTTAGTGTGTGTGA
1474GTAGAATCCCAACAAATCTGCCCTATTTTCTCAAAAATGGAGGGTTGGACCGTGCTGAGC
1475GGGGGGTGCCAGTTAGGGCGTGAGAGGGGATAGGTAAGTGTTAGGACAGGTCATAACGTA
1476GGACATCCCATAATTGTATCGGGGCGGTACTTATAATCCAGACGTAAGATTGCGATAGGC
1477ACAAAAATCGATGCCGCGACCATTGTGGCATCCTCCTGCCACAGGGATACACCTATGGCT
1478GCCTAGCAAGCATCTCTTATAACCTCACAGAGTCGTATTACACAGACCTCCACGCATGCT
1479ACGTTAGTTGTAGAAAACGAGTATCCTATAATCGGAGCTCTTCCTCGAGAAATATACGAC
1480GAATGTAAATCTGGAGTGGCGGCCGACTGGAAGCACAACATTTGCTACGGGAAAGGATCT
1481CGTATTCTTGTTCGCTCCATTGATGGCTCGGTACTTCAGAGCTATATCCTAACATAGATA
1482TCTTGGTTGCAATTAGATTCGAGAACATGTTCAGAGATGGCGGACTGCGGTCGCCGGCCA
1483AACAGGGGCAAGGTGAGCCATACCCGTATCATCGTAAGGCGTACGGCATGAGTGTAATAA
1484ACTCTTCTCAATTAACTCCGACCTTATATAATCTCAGGTTGTTCATGTCTCCCGAATTAG
1485TAGAATAGCTGATCCTAAGCTTGAGGCCGCTCGCGGAGAGGGGCTTAATGCTCATTGAAA
1486GAGACAGGGGAACGCACCACTGACGTAAACCGCTGGTAACGAGTGTAACACAGCCAAGCA
1487TGGACAGAATCTTTGGTGGATTACAGGAATCTCTTGACGAATTATGGGAAGTTGCTATTA
1488GATTAGCAATAAGAACGGTGGCGCATAAGACAAATATAATTCTCCATTGGCCATGAGTAA
1489TCATGTACTAAGCTAGTTCGCTTCGCCCAGCTTGTCCTGCTGTCGTTCGCTAAGCGATTA
1490CCAATTGAGACCTCGCAGGTTGTTAACATCCAGCCCATCGTTTGAGTAAGTTAGGATTCG
1491AGTGTATTTCCGAACAGAAGGACGGTTCTAATGTGCTCAGGCAGCCGAGTGATATCTGTG
1492GTGAGACCCCTAGTGTCCTTAGTTGGACATAGGGGAGTCTAATGAGGCTCATTTGCGGTG
1493GTCACTCTTGGTTGGTAAATCAGCTAGCGCAAACCCAGATATTTCCGCCGAGGGTGGGTA
1494TTCAAGCCAGAACTAGAGTCCTATCTCTCCTCAACCGGGGAGTCGTTGCGAGCAGGTTCC
1495ACGCCTGACAGGGCTAATTGCTATTGCGGTTGACTCACCGCAAACTAGGTAAGATCTAAC
1496TTTTCTCCAGTGGTGATGGCGGCAGAGCCGGACGAGCCACTTTGTCGGAATGGCGACAGG
1497GATAGTGTAGCTGACCGTTGTGACTGGCTATCAGCTCAGCGTCAAGCGGAACTATGGCTC
1498CTTCCAATATATGCTGACAGCATAAGTTTGAACTGTAGGACGTAATGAATGCTCGAACTT
1499TTACTGATAGTGATGAGAAGTGTTACTAGGTGCTTACTTGCTACGGGAGGGGCCCCTACC
1500GATTAGACCTTGGTAACGAAAGGCATGTTTACAAAAGACAACGGAGTGATGCGAGGTCCG
1501ACTACTAAAGAATGGTCCCCCTGTTCCGGGAGTTTCTTCTCCTATCAATCGACATACATT
1502GTGCTCGGATCGAAGACGAAAGACTTCATAACAGTTTCCTCGCCGACTGGAGAATTACAT
1503CACCGAACCCAGTGACGCCATCTACGTCTTCCTGGCGTGTATGACGCTTGTTTGTCCGGA
1504GTCCCATTTCTTACTCTCAGTACTGAATTGACGCGTCCTATGATTTCGACAACGTAGTTC
1505CTGTCCTGGGTCATCTGGCTTCTCTGCGCATGAGGCTCTCTGTTCAGAGTTCAGGAATGC
1506ACTATCCGGAACTTAATGACCTGGCCGCAAGACGACTCTGGTTCGACCGGGACCGTGAAG
1507ATTCCTGACGGTCGAAGCCATAACCGATGACGTAAAAGCCATAGCAGTCTACTAGATGTC
1508GCAGCAGCGTGTTGCAGTAAGACGATGTCGCTTCCACAGTTAGGTTTCGTCCTGTTCCTG
1509TAGGCTTGTCCTCACATAGGTTTGGGGTTCGTCACGTAATCCGTCTTCACTTCGGTAAGT
1510CAGGAAAAAATGCCCTAAAAGTATCGGCGAATCTCCTCCTCACGCGCGTCGCAGACAGGG
1511GTCTGGCCTGAATGTAAAGTGCAGTAAAGGGCCAATGCAGACGTTCTTGGTATTGGAGGG
1512CCTGCAGTCGCCTAAGCAGTGCTCAGTAAGTCTGAAGGTAACCACGGGGAGACCCGTAGA
1513GCCCACCGTCGAGAATGGCATTAACCGACCAAGGCGTTCTATTGTTCCCGCAGCCTGTTA
1514AAATGCCCAGAAGTGCGTTAGAAAGCTACGACGAAAGGGGAGTGGCAACTATTCTCGGGT
1515AGCTTCTCTCTAAGGGAGGCCTACATGGCAGCTTAGAATACGACCGTCCGGGCGTCCGTG
1516GCTCAATCAGCCCCTGTGTAACTCTGGAAGGTTCAACACCGGTTTGCGAATCCGGAACAC
1517TGAGAAGCATTTCGGAAATAAGCGAAGACTCACCGCGCTGAGCGAAGAACAATGGTGCAT
1518ACTCTCTCGGTTACCACTACCACAGAAACATCCGGAACCGTCCTGGTTGTATACTGCTTG
1519TGTCCGCCTTTTACGGTGCCCCACGAAATTGTCGAGACTTATGAACGTTTCAACGTCGTC
1520CCAGTACTCATGTCGTGCTCAAGCCAATGTATAACAAGTCTGTGAGGGTCATCGAGGACA
1521TCTACAACTTTGGGAGAGATTATAGTTAAAATGTTTATCTTACCGCTTATGTACAGCTTC
1522TTACTACTTGGGGTTAAGTAGGAGTAAATTCGTGAGGCCCTTACGTCGGCTATTGGTGTG
1523GAACGATACAGATGCCCTTTAGTTCCCAAAGGCTTTTGACGGCCATGCGCCGAACCGGGG
1524TAAATTTTCTATCCACAGTGTAATACCGATATTATTTGGAGGTTTTCACAGCATAAACTA
1525ATTAAGTTCCATTTGGTTGATCCTAGAATTCAGAAGTTGAAGTTCCCACACACGACAACA
1526TGACTAAGTGGTACGCGTGTTTAACACGATGTCGAAGAGCGAAGCGAACGTCCTCGTTAT
1527GGGTATAGTGTGTTAACAATGAATTCGTAGGGCCGCAGATATCTTGAAGATCATAACGTC
1528CCAGGGTGATGATTAGCAGAAGCCCCCGAAACCATAGGGGGAGCAGTCGCCTTGACACTA
1529CTCGTAGCGCTACGCCAATTGAGCTGGTTGTACAGCACGGGGTTAACACATTACATTTGG
1530CCGGCCTCGGAAATTATAAAAATCCAACTTTAAGGGTGTCATCAGAAGCAGCAGGGGTTC
1531GGCGATATCAACTCCGGCATGGAGATAGGTTAGAGGATGCTGTGAAAGGACATCGTATGG
1532GCGAGCTGACTTTGCTTGCCGGCCATCAGTTCACCGGAAGCACCGTACCGGTATCATGCC
1533CAGCCAAAAAGGAATTTTAACTTGGAGCGTTTTCCCCCCGCTAGTTCGGCGAAGGTGAAC
1534ATATCCAGGCAACAGATTTGACGCTAAGAATAATACCATTGATTACTAAGGCAAGTAGCA
1535GACGACTCCTATTAGTCGTGACTACCACTCGCGTAGATTCGTCCTTCCCATGGGGTTGCG
1536ATTGGTAGTTTCGATGAATCAGTGAGGTATCAGAGAAGGTCCAAGTGGTCTATTGTCAGC
1537TTGCTACTTTGACTATGGCGTAGGTACACTGAGAGGATCTTAAATATCTATGACCAGGAT
1538GGTAGCGTCAGAAGATTTAGTAATCCTTAAGGGGGCTCAACGACCAAATAGGAGGGACCA
1539CAGAGACCCCGGTGTATTAGAGCACTGCAACGATGGTTTCACTTATATGACGTGTACCCG
1540CGACCGTACTCCACAAAATGCCCATAACCCTTTTAACAAGTGTTTTATATCCAGCAGCCA
1541GATCTTCATCGGTCGGAGCACTCGCGGATTACTTGGGTGGCAAACGTCAAGGTTACGGCC
1542CCTAACGGCAAGACGCTCGAGAGCAGGGATTCAGCAATTCTTTTACAATGACTGGTACCA
1543AACCTGCTCAAAATTAATATCAAAGTTGAAGACTCACTTGTTGTGCAGAAGGCGGTCGGC
1544GAGTATTCGGAGCGCTACGAGAGTGCGATACCCTCCTAGCTGTACCACGGCAGATACGAA
1545GGCTCGAATTGGCCGGGGTCACCGCCTGTTGCCTCTGCTCACTGTCACAAGACATGCGAA
1546CGCTCGGTACAATTGGCTTCTGCAGAGTGGTAAATCTCCTGCTCCGTGCTTACAATCGGT
1547ACTACGCATGTGATTCCTTGGGGTGGGTAATACGAGCCTAAGGACGCGCAATGGGAAAAA
1548ATACCATGGGTGCCGGTTCATCTCACCACCCCACGGGGAAATGCCAAATCCGGATGGATT
1549GACGCTATCCTGACTCCTGAATGTTCCCGACAAGGGCTCTACCAGAGAAAAATTTGACAG
1550CCGGTCAAACTAGAACCGCCGCCCACACGATTCGCATCATTATCATGCGTGACAGCCGGT
1551GGGTAATTCTGATCGAAACGAATCACGCTCACTGATGTGAGAAGCGGCTTATTTATAGAT
1552TAAGTACCTTCCTGTAACGTCGGACGACCAAACATAAACTATATCAACCGCGATTCGTGT
1553TGTAGGAGTGCTCCGGCGTTAACAAACGTTCTCATTTACGGGCTATCCGAAGCGTCGATG
1554AACCAACTAGCGCGCCGGGATTGACCCTGACGAGTATAATTCGAATCGGTGCGACTGGTA
1555GAGGTCGGGGCCATCATGGCCAGAATTGCGGTTACGGTAAGCCGCGGAAACCATCAGCTT
1556TCGGGTAAGAAAGCGTTATTAAAATGCCTAAGCGCTCCTTGTAAAGTTTGGTGTACCCGA
1557CGGGATGCCCATCATCTGCGATCGGCTTGCTTTGGTCAAGCACGCAAAGCGGATATCTGT
1558AGTTACGCCGAGTCCAGCAAGGTGCTCGTAGTGCTGGCTTATCTCGTTTTTCCGAGGCCC
1559CTATATCGCCCCAGACCTAAGAGTGGCATGCCCGACCGTGTATTTTCAGCAACGTAACAA
1560TGCCACGCTGAGGTGCTTCCAGGGACGCGGCGAGTATCGTTGCGCTTAGCGTTACTCTAA
1561CCGGTCGTGAGGGTAATTACAGATGCTAATAGCGAATGTCTCTCCTCATGCTAGTTTGTA
1562CTGGCGTAAGCTACCCAGCTAGTCAGAAATACGGATATTACAACCCGGTTCAGACGGCGG
1563AGAGAACATACAACGGGAACACCGGGAATTTTCTCGTGGGGTGTAACGCCACGCTAATCT
1564GATATAGGTAACAGAATCTAGTCCAACATGAGGTGCTATGATAAGACCGACATGCTGTAC
1565CATATCCGCCCGACGGCTTTTAAGGCGAAGGGGCGCTTTAAAGCCCTTATGATGGGAAGA
1566GAGAGACCACCACACTCCGCAACTTACTAATTAGTGGCTGGCTTCAGGCATCCCCACGTC
1567GGATAACTCCCTGAGTCCCGCAAGCCGGTCAGAACAAGTCTCACCTAGACCCGCATGGGC
1568AGTAGAATTAAGCCAGAACAGGCATCTCACGATGAGGACCACACGAAGACGGTAGGCGTC
1569TCCTTCCGGGTGTTAGTAAACTGATCGATCGGGTCGCGATATCATCGGCGGGCCGAGACC
1570CTTAGCGTTGGACAAACGTTACCGGAGAATCGGCGCGAACGTCTTCAATTTAACGTCATC
1571ACTGGCTACACTTTTGATGAGGAGTGCAGCCGGCCAGAAAACTTAGCCCACTGCGCTTCC
1572AGAGTCGGCGGGACCAATCCTGCCTTGGGTATCACCCATGGCAGGGTGCAAATCCGATCG
1573GCCTCTAGTTACACATTTCATCAGGCCGAGCGTGCACGGACGGGTGCGCGGAAGTGTACT
1574GGCCATCGCTGGCAACGCTTAGAAATGATTTCCCGGATACGGTTTAACCACCGCCGAAGT
1575TGACTGTTCTATCTGATTGCTTGCAATAAGTTATATCTGGGGCACTACGGGCCAGCAGCA
1576AAAATATAACGGTTGATTCCCTTTACAATGCTGCTGCGGCTCAGAGTTCACTAAGACGAC
1577ACATGACAGTCGACACATACACAACGATCAACGAAAACATCGCCTCGTCTCCACCGACCC
1578CCGTCTAGAACCGGTGTCCAAGCCAGTATACCCTAGGAATCCATTTCTCTTCCCGCTCCT
1579CGAGGACACCTGTACGTTCAGCGTGACCGGATCAGTCTTGATATTCGGATTGACGGCTAT
1580CATGCCCGACAAAAATCGCGCAAGCGATCAGTCCCGGTAGAATAATTCCATGCAAGGCCA
1581CATGCAAATAGTACTAAGGCTCAACAGACAATATCCTGCTGAGTCGTGACTTTTTAAGAC
1582GAAGTGTTACGGCACGGCATGAGCTGGTAGCGTCAGTTCTATGCATAGAACTAAAAGGTG
1583CAAAGAGCTACATTCTGCGTGTGGTGGCCGTGGTGATAGTATTAGATAGCTACCGAACGC
1584TCTCCCGACATGTGGCTCCCTCCAGTAGAGTTAGCCTTCCTCTGTCTGGATCCACAAGGA
1585AGAAACCAATCTAACTCAGTACCGGGGGAAGCGGCTTTTTGAGGATCCTTAACCGTAACA
1586ATCTGTGCGCCACTGCTTGGTGGAAATAAAACTGACCGTTTATATCCGATCTCTTCAGCA
1587GGCGACTCTGAGGTGGATAAGCAACTCCGTCACTGCAGGAAGGTCCCCACCTTCTACACT
1588TGTACGCGATGACATGCATGGCCCGACTAGGAAGAGAGAACGATGACAACGGGTTATAAT
1589GGTTAACAGCATTCGCCACCCTATGTTCATCGGACGAGTGTTGGAAACACTCCTATGACG
1590TGCCGGATCTCAGTTTATAAATGCGGCCGGTGAATGTTCAGTACGTAGGATTACAGTCTG
1591TTATTTGGTTGCGTGCGGTCTGATTACTGCCCACCTATGTGACCTTGGGCTCATATTCGC
1592GTTGAAGCTAACACGACAGTGCAGAACTCACATAGAAACTACACTTCATTTCATTATCTA
1593CAAAATAATCTATACGTGGGCCACATCTAATCCAGCTGGGACGTCTCACTTGATTAGATT
1594CGAGGGTCCCACTGAAGCCTAAGATCACGTATCCCATACAGCCCACCGGGCGGTGCCGTT
1595CTGTATTATAACGGGGTAAGGCACCTGGCCCTCTGCGCCCCGTTACCTCCCATGCACTGG
1596CTCGGTTAACCGTACTGTGTAATTGATTACCCATTGGGGTTACGAGCGCAGGACCGGCCG
1597GGTTCGCAAATAAAGAGATAACGAGTGAATGTCCGTTTTATGATGGAAGTAGAGGGGATG
1598TCCCTTAGTTGGCGGTCGTTCAGCGATACGTAAACTACCTAACCGTATCATGACTGCTTG
1599CGTCGAAGGGCGGTAAGAAAATGAAGTCCGAGATAGTACCGGAACACAACACAGCAAACC
1600GCAGAACAAGCTACTGCAGGCGTCAACCCTGTAGGCGTCTCGGCACTCGCTTTGCATGCA
1601CTTGGCTAAATCGCTGTGACATATGCTCAACCAATGGGGGGGACTTTGCTTCTACCCAGC
1602CTTCTGTCCCATTAATTACATCGGCTTGTCAAATCACACGGCGCCGAAGGCGTTAAGAGC
1603CGGGCTGTATCGCTTGGATAGAGCTTCCTTGAGAGTAAGAAAGCTCTCCGGTGAACTCGG
1604CCTTCCGCGCCGCTTACGGGCAGTAGCAATGCACAGTGTCTCTAAGCCATACTGCTAGTA
1605CGCGTCAGATTTAGACACGCAGGTATGCCGCTATCTACGAACACAAGACACCTAATTGAC
1606AGAACCACGGGGTGTTGCATGCACCAACGCGTTGTATTCCCTTCCTATAAGGGGTTGAAC
1607CGAAATATTCAACACGTGGTGAGATCACCAGGTGGTGGTCATCCTTTGCCGTGAACCAGT
1608ACCTTATCGGGGCATCTTTAACTGCTTTTGGATTTGTGAGAGAGGATCTGCTACGCACAA
1609TGAGGTCCGCTGTAAGATTTGCGGGATGGAGCGGAAGCGAGCGCCTTCGTAAATGGTGAC
1610GTTACTCTATTGAGTGCTTTGAAGTGAGAAAGTTTCGAAGTAATGTCTGCGACGGACGGC
1611TGAGCTTTTACGACCGCTCTATACGGCTCTAAGAGTTGTGGAAGGGATCCGCAGGGCTCG
1612GGGAGAAGGTAATCGCTGAATTCACTGGGAAAGGCATCGCATGTAACTTCTGAAGGTCAC
1613CCCTTGTGTGATCGTCGAACCTAGTGAGTATACATCTTTGCTGGCCTACTCGGCACAATT
1614CGAGGTTCGTATGGCATAAATCGCTTGTTCGATGTGGGTACTAACCAAGAACCTTAGCTC
1615TGGGACAGTATCTTCCACCGCGAGCTTTAGATAGGCTGTTGGAGCCTGGAATGACTTAGA
1616TTTTCCACAAAGGAAACTGTAGGGTTGGAAGTTGGCTTGTTGGCGGCTGTGGGAACTGTT
1617TGGGACTTACTTTCACTGACCGTTGAAGGACCGAAGCTCCCAAACAGCGGGACGTTGACA
1618ATGGTGAACCCGGCTTCCAATTAACTATTCTTACCTTCTCTATCCGATTCTTATTCGTAG
1619CTCCCTCAAACTCCAGTCCTGAGGTCTGCTAGGCTTAAACCCAGGCAGGGCAGTGGACAC
1620AATGCTGGTGTATTGGATAGCCGTAACACCGCCCATAGCAAAATTTCAGCGTGCGGCATT
1621CCATGAGTGTTGTTGGGTGACCTTGGGTGCGTGTGATATGTGAGGGCAGTCTAAGGGAGA
1622CAATTGATTTCGGCCAAGAGCCCGGTAAAGCCTCCGTCCGAGCGAGGAATGCATTGGATG
1623GAACCCAAGCTGAACAGTAGGGTTCTCTTAGCAGTCTTGCACTACAATAACGGACTTTTG
1624TCAATTCGGTTGAGTCTTATACCGGTGCGCACGACCTTTCGGTTAGATGCGGGAAATGGC
1625TGGCGAGCTCGCTCAAACTGGGAAGACCTTGGCAATAGATAGCTTCTTGTCACCCTGGAC
1626CGTGGTCTGCGGTTCGCCGTATACCCATTAAAGTGATTTCAGTTCACGCTGCTGGATGTG
1627GTGAGACCTAGTGCGAGTGTTACGGTGCGCTAACCGCGAAGGTCACCGCTCAAGGGGAAA
1628CTACCCTGTTTGGGTGAAACTCCTATGGTGGACGCGAACTAACGGAAGAATACATCTCTG
1629TCGCATTAAATAACGTCGCGGCGTCCCCTATGGGTGCTGCTCCAGTTACAGTCATTCAAA
1630ATTGCGATCGACAGCGCAGTAAGGACCGCCGGACAGACCCTCGTTTGCTAAACGGCATTC
1631AGTATAGTCTCACTAATGCGGCGTAACATACTGCAGCGCGGGGTGGTCACTTGGGGGTGG
1632AACGCCAGAGAGAGCGCATCCTAACTGTGCCGCTCGACAATAGAGTGTAGCCCCCGAACT
1633CTCGGGAGAATTACTGCGGCATGCAATCAAACTCTCATAATTTTATCCCTGCGCGTCCAC
1634CAGCCCGCAGCTCCGGATTCTGGCTAAACACGATTGAGTAACTGGCAGATTTCCCACCAG
1635GCAGAAAAGAAGCTATAACCAAACCCGGTGACAATAAACGACCCCCACGCGGCTTGACAT
1636AAAAAAACACTATACAGCCAGAGTTCCTTCTTCTTCTTGTCGTAGAAACCATCGGAATAT
1637ATGCGCTGACCCTCCGCCGTTTGACCCCACACAGGGTCAATGCGTTAAATTTGGATTCCT
1638GCAGATATACTTTCGGAGGACGATAATTCAGTCTCCGCCGGAGCCATCGGGAAGTAGGTT
1639GCGAATCGAGCTTTAATAGCGACGGCGATCTGGCGTATCAGGTCCACAATGGTTACAGCA
1640TAGCCAACTGGCACGGCAGCTATTATAACGAAGGGAGGCGATTCCGTGGCACGTAGTCGA
1641TTCCCTCACTGGGCTTTGGCTGTCCTTAAGCTCGCGCGGGCAAAGTTCCCTCTGGCCGCG
1642AGCCAGTCCGAGGAGAAGGCTCGTTCAATCGTAAAAGTGTCGGAGAAGGGAGTGCGTCTG
1643GCCGCCTACCTGTCGCGTAACAGCGTTGAGATAGCCTACACCTAGCGAAGCGGTTATGGT
1644CTGCCAGAAACGCAGTCAAGGCAAATCTCTTGGCTTCGAGGCATCGGGTGACTAGATTTC
1645GGTCATACCATTCTGGGACCTCGGGAGCTGGGAGTACTGGACCCCTATTCAGGGCATTGG
1646CAAGGTGTTACTGGATCAGCCGTAAAATAGGCTGTCGGCCGGAACATGCCTGTTGATTTT
1647CCCAAAGGGTTCCTCGTCCAGATGTCGTACGGTTGTAACGTATCTCTGGATACGGATATA
1648GGGCCAACCCAACTCAACGGCCTGTCTTGGTAACCGCCTGGTTTTATTCCGTTCCGGACA
1649TAATCCCTGCCAAATTCGTGACCTGTCATTCGTCGCTTACACGCGCATATCAATTGGATC
1650TAATCGAACAGGCATTCTGCTACTTAGCCCGACGTGATTGTCACCTAGGTACTCCGGTTT
1651ACTCATTAGGGGTGTACTTAGTCCAGTGCGCCACGAAGAGATAACTATTTTCGATTTGCA
1652CTGCAACAGCGTATTGGTCCTATCAGATAGACCGGCGTCCCTACGTTCGAGCACTCTTAA
1653CACGGATCTAGAAGGGCCTTGGCGTATTTATCAATTATAATGATAGGCACAGTCATCAGC
1654ACGACCTGATGACGTCCCGCTTTGATCGTTTTACAGGTATTGTAAGGCAAGTTCCACTGA
1655GCATGACATCTGTGTTCCCCCTACCCCGATGTAGGGGTGGAGATATGCATGGTGTAAAGA
1656TATTTCCCATTACATGTGTACGGAACAACGCATATGGATGTTTCTGTGAGGGAAGCCTCG
1657CGGATCGCCGTCCGGACCGCTCTACGCTCGCGCATACCCTTAAATGAATTCGACGCTTAA
1658GGGTGCTTTAGGAGTTATTTGCGGGAACAACGGTCACAAAAGGACCACCTCTATGGTGTT
1659GACCAGCCGCCGATTCCTGGGTCTGTCGCCCACTCCCGGAATGATCCAATGTTTGCTTTA
1660ACAGACTCAGCACAAACCAGAGCTGTCCGACTCGCCTATTGATAATAGACACTCACACGG
1661GACTGGCCTACCAACCAGTATTCGAGAATGGCGACAGGGCGTTGTATTGGACCCACTACT
1662GAACACCGTTACGTAGTTCGGCTTTTCGTGCGGGTGTACTACAGAAATAGCGTCCGAGCA
1663CGGTACGACTTCATAAAATAGCGGGTAGGCGTAAGACAATTTATTATTCTTTACCGAGAG
1664TTCTTAACAAAAAATTCTGGGCCGGTAGCACATGATGAATAATAAGTCCCTTGCCAACTC
1665GACCGCACCAAGATGCCGGTTGGGTAGTCCATCCCATCCAGCGGACTCTGAGATATTTGA
1666AGAGTCGGGTTAACTAGGCCAGAACATATCAATAGTCACATAATGTTAGAGGGGTTGGTG
1667AAGTAAGGAAGTAGGGGCTACCGATCTCATTATCTTCGCCGTAGGGCATAACCGCAAACA
1668TCAGGTGACTCTTGGCATCATCCATGATGCTGGTACTGCA